Incidental Mutation 'R7959:Tmem184c'
ID650006
Institutional Source Beutler Lab
Gene Symbol Tmem184c
Ensembl Gene ENSMUSG00000031617
Gene Nametransmembrane protein 184C
SynonymsTmem34, 8430433H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R7959 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location77595982-77610698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77602903 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 176 (V176A)
Ref Sequence ENSEMBL: ENSMUSP00000034030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034030] [ENSMUST00000141202] [ENSMUST00000152168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034030
AA Change: V176A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034030
Gene: ENSMUSG00000031617
AA Change: V176A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Solute_trans_a 48 317 1.9e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
internal_repeat_1 422 485 1.18e-11 PROSPERO
low complexity region 500 512 N/A INTRINSIC
internal_repeat_1 519 599 1.18e-11 PROSPERO
low complexity region 600 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141202
SMART Domains Protein: ENSMUSP00000120041
Gene: ENSMUSG00000031617

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152168
AA Change: V216A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114463
Gene: ENSMUSG00000031617
AA Change: V216A

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Pfam:Solute_trans_a 85 228 1.4e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik A T 2: 28,462,357 N131K probably damaging Het
Ahnak T C 19: 9,010,649 V3099A possibly damaging Het
Apba2 A G 7: 64,695,823 M254V probably benign Het
Bbs7 C T 3: 36,602,936 D248N probably damaging Het
Cldn8 A G 16: 88,562,941 V32A probably damaging Het
Col4a4 G T 1: 82,507,059 P496T unknown Het
Cyp27a1 T A 1: 74,737,077 N417K probably benign Het
Dnah7a T C 1: 53,643,462 D283G probably benign Het
Fmn1 T A 2: 113,365,622 Y556N unknown Het
Fsip2 T C 2: 82,985,776 I3951T possibly damaging Het
Gigyf1 C T 5: 137,524,319 T773I probably damaging Het
Gm11639 A G 11: 105,042,801 K4878E probably damaging Het
Gm8251 T C 1: 44,057,568 I1457V probably benign Het
Heatr6 A T 11: 83,781,363 K1066* probably null Het
Ikbkap A T 4: 56,774,737 M746K probably damaging Het
Mdfic T C 6: 15,741,071 S142P possibly damaging Het
Mettl16 A G 11: 74,817,026 I389V probably benign Het
Mia3 T C 1: 183,344,339 Y57C probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nup160 T C 2: 90,713,895 probably null Het
Olfr12 T A 1: 92,620,307 C134S probably damaging Het
Olfr138 A G 17: 38,275,711 *313W probably null Het
Olfr20 T C 11: 73,353,918 L55P probably damaging Het
Olfr628 T A 7: 103,732,808 V294D probably damaging Het
Olfr904 T A 9: 38,464,915 S291R probably damaging Het
Plcxd1 A T 5: 110,103,556 I333F probably damaging Het
Plxna2 AT A 1: 194,793,864 probably null Het
Plxna2 C A 1: 194,810,962 S1848R probably damaging Het
Pnpla2 T A 7: 141,457,493 D136E probably benign Het
Polr1b T A 2: 129,108,094 F245I probably damaging Het
Prmt9 T A 8: 77,560,965 I245N probably damaging Het
Serhl A T 15: 83,101,872 D62V probably damaging Het
Sh3rf3 A T 10: 59,007,103 D297V probably damaging Het
Spata13 C T 14: 60,756,230 R1044* probably null Het
Strbp G A 2: 37,640,894 T116I probably benign Het
Supt5 T C 7: 28,315,799 D977G probably benign Het
Uhrf2 A G 19: 30,086,260 N541S probably damaging Het
Vmn2r24 T A 6: 123,778,990 F7Y possibly damaging Het
Vmn2r27 T C 6: 124,192,081 R697G probably benign Het
Zfp994 A G 17: 22,202,780 V18A probably damaging Het
Other mutations in Tmem184c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Tmem184c APN 8 77597146 nonsense probably null
IGL02024:Tmem184c APN 8 77604814 missense probably benign 0.10
IGL02231:Tmem184c APN 8 77604812 missense probably damaging 1.00
IGL02736:Tmem184c APN 8 77597846 missense probably damaging 1.00
IGL02934:Tmem184c APN 8 77597820 missense probably damaging 1.00
IGL03046:Tmem184c UTSW 8 77599657 nonsense probably null
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0107:Tmem184c UTSW 8 77597073 missense possibly damaging 0.78
R0189:Tmem184c UTSW 8 77597812 missense possibly damaging 0.92
R0564:Tmem184c UTSW 8 77606160 splice site probably null
R0946:Tmem184c UTSW 8 77604757 missense probably damaging 1.00
R1629:Tmem184c UTSW 8 77602922 missense possibly damaging 0.87
R1629:Tmem184c UTSW 8 77606162 critical splice donor site probably null
R2261:Tmem184c UTSW 8 77597043 missense probably damaging 1.00
R2261:Tmem184c UTSW 8 77597175 missense probably damaging 0.99
R2919:Tmem184c UTSW 8 77604647 missense probably damaging 1.00
R3805:Tmem184c UTSW 8 77596875 missense unknown
R5418:Tmem184c UTSW 8 77597820 missense probably damaging 1.00
R5716:Tmem184c UTSW 8 77606407 missense possibly damaging 0.90
R5934:Tmem184c UTSW 8 77604723 nonsense probably null
R5951:Tmem184c UTSW 8 77598662 splice site probably null
R6150:Tmem184c UTSW 8 77596440 missense probably benign 0.04
R7206:Tmem184c UTSW 8 77596577 missense possibly damaging 0.46
R7387:Tmem184c UTSW 8 77597930 nonsense probably null
R7899:Tmem184c UTSW 8 77597811 missense probably damaging 1.00
R8100:Tmem184c UTSW 8 77604782 missense possibly damaging 0.92
R8246:Tmem184c UTSW 8 77610185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCAGCCTTTCACTGTTAATC -3'
(R):5'- TTTCAAAATGGGCTTCAGGC -3'

Sequencing Primer
(F):5'- CTACCATTAGTTGCCATGAACGTGG -3'
(R):5'- GGCTTCAGGCTCCCTTG -3'
Posted On2020-09-15