Incidental Mutation 'R8426:Kif5a'
ID653487
Institutional Source Beutler Lab
Gene Symbol Kif5a
Ensembl Gene ENSMUSG00000074657
Gene Namekinesin family member 5A
SynonymsKhc, Kns, Kif5, D10Bwg0738e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8426 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127225696-127263348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127231489 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 853 (D853G)
Ref Sequence ENSEMBL: ENSMUSP00000096775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895]
Predicted Effect probably damaging
Transcript: ENSMUST00000099172
AA Change: D853G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: D853G

DomainStartEndE-ValueType
KISc 7 335 7.38e-173 SMART
low complexity region 340 362 N/A INTRINSIC
coiled coil region 408 539 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
coiled coil region 632 800 N/A INTRINSIC
coiled coil region 822 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217895
AA Change: D853G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,471,426 A352V probably damaging Het
Abcb11 T C 2: 69,325,262 H32R probably benign Het
Abcb1b T C 5: 8,861,632 probably null Het
Aicda A T 6: 122,561,191 N103Y probably damaging Het
Bsn T C 9: 108,126,573 E211G probably damaging Het
Casp9 T C 4: 141,813,625 Y435H probably damaging Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,397,572 probably benign Het
Ceacam5 T C 7: 17,759,341 V763A possibly damaging Het
Cxcr6 A G 9: 123,810,006 N31S probably benign Het
Gm17728 A G 17: 9,422,399 T114A probably benign Het
Gnao1 A T 8: 93,896,229 probably null Het
Iffo2 A T 4: 139,614,980 Y451F probably damaging Het
Ints4 G A 7: 97,501,032 W258* probably null Het
Ipo11 T C 13: 106,842,170 D834G possibly damaging Het
Lama4 A G 10: 39,103,491 E1655G probably damaging Het
Lepr G A 4: 101,814,644 S955N probably benign Het
Lrp1b T C 2: 41,498,306 I550V Het
Mov10l1 T A 15: 88,997,405 probably null Het
Mroh9 A T 1: 163,024,725 D798E probably damaging Het
Myo10 A G 15: 25,799,490 I1380V probably damaging Het
Neu2 C T 1: 87,596,665 S124L probably damaging Het
Nol6 T C 4: 41,119,870 I543V probably benign Het
Nrxn3 G A 12: 88,795,327 R48H possibly damaging Het
Ogn C T 13: 49,621,091 R237C possibly damaging Het
Olfr432 T C 1: 174,050,580 L69P probably damaging Het
Olfr910 A T 9: 38,539,324 Y143F probably damaging Het
Phf24 C T 4: 42,933,785 Q19* probably null Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ptch2 G T 4: 117,108,172 S318I possibly damaging Het
Sart1 A G 19: 5,383,741 M356T probably benign Het
Slit2 A G 5: 48,224,763 N529D probably benign Het
Smchd1 A C 17: 71,448,603 D261E probably damaging Het
Tcerg1 G A 18: 42,548,401 V538I possibly damaging Het
Thada A T 17: 84,222,703 M1746K probably benign Het
Thsd1 A G 8: 22,243,638 I234V probably benign Het
Tm9sf4 G A 2: 153,203,816 G536D probably damaging Het
Tmprss11c G T 5: 86,231,818 N410K probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Unc5d G T 8: 28,719,988 S440Y probably damaging Het
Vmn1r44 A G 6: 89,893,488 D72G probably benign Het
Vmn1r68 T C 7: 10,527,455 N239D probably benign Het
Vmn2r107 T A 17: 20,356,977 H412Q possibly damaging Het
Other mutations in Kif5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kif5a APN 10 127239196 missense probably benign
IGL01405:Kif5a APN 10 127245990 missense probably damaging 1.00
IGL01637:Kif5a APN 10 127245368 missense possibly damaging 0.94
IGL01894:Kif5a APN 10 127262779 missense probably benign 0.04
IGL01978:Kif5a APN 10 127245739 missense probably benign
IGL02039:Kif5a APN 10 127233867 missense possibly damaging 0.95
IGL02052:Kif5a APN 10 127243499 missense probably damaging 1.00
IGL02336:Kif5a APN 10 127242696 missense possibly damaging 0.87
IGL02352:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02359:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02834:Kif5a APN 10 127245756 missense probably benign 0.00
IGL03101:Kif5a APN 10 127235609 unclassified probably benign
brittany UTSW 10 127248254 missense probably damaging 1.00
spaniel UTSW 10 127230578 missense probably benign 0.00
R0463:Kif5a UTSW 10 127235652 missense probably benign 0.00
R0790:Kif5a UTSW 10 127246009 intron probably benign
R1070:Kif5a UTSW 10 127245406 missense probably benign 0.00
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1502:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R1812:Kif5a UTSW 10 127242010 missense probably benign 0.03
R1837:Kif5a UTSW 10 127236815 nonsense probably null
R1838:Kif5a UTSW 10 127236815 nonsense probably null
R2012:Kif5a UTSW 10 127239175 missense probably benign
R2072:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2073:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2074:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2075:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2440:Kif5a UTSW 10 127231336 missense probably benign 0.34
R3157:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R3688:Kif5a UTSW 10 127242774 missense probably damaging 1.00
R3740:Kif5a UTSW 10 127243468 missense probably damaging 1.00
R4782:Kif5a UTSW 10 127230954 missense probably benign 0.01
R5049:Kif5a UTSW 10 127239839 missense possibly damaging 0.93
R5723:Kif5a UTSW 10 127231029 frame shift probably null
R5764:Kif5a UTSW 10 127231029 frame shift probably null
R5838:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R5903:Kif5a UTSW 10 127230578 missense probably benign 0.00
R6299:Kif5a UTSW 10 127233821 missense probably damaging 1.00
R6384:Kif5a UTSW 10 127242775 missense probably damaging 1.00
R6629:Kif5a UTSW 10 127248254 missense probably damaging 1.00
R7463:Kif5a UTSW 10 127243724 missense probably damaging 0.97
R7558:Kif5a UTSW 10 127248079 missense probably damaging 1.00
R7567:Kif5a UTSW 10 127237379 missense probably benign 0.00
R7733:Kif5a UTSW 10 127236740 missense probably benign 0.00
R7853:Kif5a UTSW 10 127235668 nonsense probably null
R7869:Kif5a UTSW 10 127243474 missense probably damaging 1.00
R7896:Kif5a UTSW 10 127242004 missense probably benign
R8085:Kif5a UTSW 10 127239309 missense probably benign 0.00
Z1177:Kif5a UTSW 10 127229823 missense probably benign 0.00
Z1177:Kif5a UTSW 10 127236967 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAAGCGTTGAGTGGTCTG -3'
(R):5'- TAGAGCCACACACTGCTAGAG -3'

Sequencing Primer
(F):5'- ACTCACCGATCTGGGCAGAATG -3'
(R):5'- GCTAGAGCAAGGAGGTCCC -3'
Posted On2020-10-20