Mutagenetix > Incidental Mutation

Incidental Mutation 'R5903:Kif5a'

456455

Institutional Source

Beutler Lab

Gene Symbol

Kif5a

Ensembl Gene

ENSMUSG00000074657

Gene Name

kinesin family member 5A

Synonyms

Khc, Kns, Kif5, D10Bwg0738e

MMRRC Submission

044101-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5903 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127225696-127263348 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 127230578 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 990 (M990L)

Ref Sequence

ENSEMBL: ENSMUSP00000151402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895]

AlphaFold

P33175

Predicted Effect

probably benign
Transcript: ENSMUST00000099172
AA Change: M990L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: M990L

Domain	Start	End	E-Value	Type
KISc	7	335	7.38e-173	SMART
low complexity region	340	362	N/A	INTRINSIC
coiled coil region	408	539	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
coiled coil region	632	800	N/A	INTRINSIC
coiled coil region	822	905	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217895
AA Change: M990L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.8%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130230L23Rik	A	G	5: 65,988,318	V150A	unknown	Het
Abraxas1	T	C	5: 100,817,958		probably null	Het
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atg2b	T	C	12: 105,639,359	D1449G	possibly damaging	Het
Atg7	G	A	6: 114,706,293	W439*	probably null	Het
Atp6v0a2	T	A	5: 124,712,279	I370N	probably damaging	Het
B4galt1	T	C	4: 40,807,760	D347G	probably damaging	Het
Baz2b	C	T	2: 59,959,889	C660Y	probably damaging	Het
Ccdc88c	T	C	12: 100,930,542	Y1390C	probably damaging	Het
Cdcp1	G	A	9: 123,173,772	Q745*	probably null	Het
Cep97	G	A	16: 55,919,526	S185L	probably damaging	Het
Clec4d	A	G	6: 123,267,061	H43R	probably damaging	Het
Cntn3	T	A	6: 102,242,133	M509L	probably benign	Het
Cntrob	A	C	11: 69,309,375	S564R	possibly damaging	Het
Cyp2j8	T	A	4: 96,507,277	N37I	possibly damaging	Het
Edc4	A	G	8: 105,890,587	T1029A	probably benign	Het
Fam160b2	A	T	14: 70,591,681	V64E	probably damaging	Het
Fmnl1	G	T	11: 103,171,444		probably null	Het
Fzd6	T	A	15: 39,007,388	M1K	probably null	Het
Gle1	C	A	2: 29,940,281	T283N	probably benign	Het
Hsd17b14	T	C	7: 45,565,962	V161A	probably damaging	Het
Hsf2	T	C	10: 57,504,723	S218P	probably benign	Het
Ipo7	T	A	7: 110,050,813	C736S	probably damaging	Het
Itpkb	G	T	1: 180,413,975	V737L	probably damaging	Het
Itpr1	T	C	6: 108,489,797		probably benign	Het
Kcnh8	G	T	17: 52,803,336	V192L	possibly damaging	Het
Kctd10	G	A	5: 114,380,462		probably benign	Het
Kdm3a	C	A	6: 71,632,250		probably benign	Het
Klf12	A	G	14: 100,022,688	S202P	probably damaging	Het
Krt81	T	G	15: 101,460,202	Q390P	probably damaging	Het
Lrig3	T	C	10: 126,008,478	S604P	probably damaging	Het
Ms4a1	A	T	19: 11,258,248	V48D	probably damaging	Het
Mta1	C	T	12: 113,136,619	P688L	probably damaging	Het
Oas1h	T	C	5: 120,870,977	V250A	probably damaging	Het
Olfr618	G	T	7: 103,597,921	G202*	probably null	Het
Olfr95	A	T	17: 37,211,021	Y277*	probably null	Het
P2rx3	T	C	2: 85,000,727	E265G	possibly damaging	Het
Pdzd8	A	G	19: 59,345,286	I101T	possibly damaging	Het
Psme4	A	T	11: 30,841,589	N1148I	probably benign	Het
Rnf213	T	C	11: 119,421,369	L874P	probably damaging	Het
Sart3	T	C	5: 113,751,239	Y508C	probably damaging	Het
Sez6l2	T	C	7: 126,970,133		probably benign	Het
Slc9b1	C	T	3: 135,392,894		probably benign	Het
Stmn3	T	C	2: 181,308,780	K78E	possibly damaging	Het
Thsd4	T	A	9: 60,394,106	N302I	possibly damaging	Het
Trdv5	A	T	14: 54,148,785	H74Q	probably benign	Het
Tubb4b	C	T	2: 25,223,981	R77H	probably benign	Het
Ugt1a6a	C	T	1: 88,215,123	P113L	probably damaging	Het
Unc5a	T	A	13: 54,999,690	C438S	possibly damaging	Het
Zan	C	A	5: 137,442,134	C1946F	unknown	Het

Other mutations in Kif5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Kif5a	APN	10	127239196	missense	probably benign
IGL01405:Kif5a	APN	10	127245990	missense	probably damaging	1.00
IGL01637:Kif5a	APN	10	127245368	missense	possibly damaging	0.94
IGL01894:Kif5a	APN	10	127262779	missense	probably benign	0.04
IGL01978:Kif5a	APN	10	127245739	missense	probably benign
IGL02039:Kif5a	APN	10	127233867	missense	possibly damaging	0.95
IGL02052:Kif5a	APN	10	127243499	missense	probably damaging	1.00
IGL02336:Kif5a	APN	10	127242696	missense	possibly damaging	0.87
IGL02352:Kif5a	APN	10	127243501	missense	probably damaging	1.00
IGL02359:Kif5a	APN	10	127243501	missense	probably damaging	1.00
IGL02834:Kif5a	APN	10	127245756	missense	probably benign	0.00
IGL03101:Kif5a	APN	10	127235609	unclassified	probably benign
brittany	UTSW	10	127248254	missense	probably damaging	1.00
spaniel	UTSW	10	127230578	missense	probably benign	0.00
R0463:Kif5a	UTSW	10	127235652	missense	probably benign	0.00
R0790:Kif5a	UTSW	10	127246009	intron	probably benign
R1070:Kif5a	UTSW	10	127245406	missense	probably benign	0.00
R1404:Kif5a	UTSW	10	127245442	missense	probably benign	0.12
R1404:Kif5a	UTSW	10	127245442	missense	probably benign	0.12
R1502:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R1812:Kif5a	UTSW	10	127242010	missense	probably benign	0.03
R1837:Kif5a	UTSW	10	127236815	nonsense	probably null
R1838:Kif5a	UTSW	10	127236815	nonsense	probably null
R2012:Kif5a	UTSW	10	127239175	missense	probably benign
R2072:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2073:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2074:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2075:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2440:Kif5a	UTSW	10	127231336	missense	probably benign	0.34
R3157:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R3688:Kif5a	UTSW	10	127242774	missense	probably damaging	1.00
R3740:Kif5a	UTSW	10	127243468	missense	probably damaging	1.00
R4782:Kif5a	UTSW	10	127230954	missense	probably benign	0.01
R5049:Kif5a	UTSW	10	127239839	missense	possibly damaging	0.93
R5723:Kif5a	UTSW	10	127231029	frame shift	probably null
R5764:Kif5a	UTSW	10	127231029	frame shift	probably null
R5838:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R6299:Kif5a	UTSW	10	127233821	missense	probably damaging	1.00
R6384:Kif5a	UTSW	10	127242775	missense	probably damaging	1.00
R6629:Kif5a	UTSW	10	127248254	missense	probably damaging	1.00
R7463:Kif5a	UTSW	10	127243724	missense	probably damaging	0.97
R7558:Kif5a	UTSW	10	127248079	missense	probably damaging	1.00
R7567:Kif5a	UTSW	10	127237379	missense	probably benign	0.00
R7733:Kif5a	UTSW	10	127236740	missense	probably benign	0.00
R7853:Kif5a	UTSW	10	127235668	nonsense	probably null
R7869:Kif5a	UTSW	10	127243474	missense	probably damaging	1.00
R7896:Kif5a	UTSW	10	127242004	missense	probably benign
R8085:Kif5a	UTSW	10	127239309	missense	probably benign	0.00
R8426:Kif5a	UTSW	10	127231489	missense	probably damaging	0.99
R8750:Kif5a	UTSW	10	127248040	missense	probably damaging	1.00
R9206:Kif5a	UTSW	10	127243358	critical splice donor site	probably null
R9497:Kif5a	UTSW	10	127243484	missense	probably damaging	1.00
R9747:Kif5a	UTSW	10	127238753	missense	probably benign	0.00
Z1177:Kif5a	UTSW	10	127229823	missense	probably benign	0.00
Z1177:Kif5a	UTSW	10	127236967	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTCCACATGAATCGTACC -3'
(R):5'- CTCCTTGTCGCCATGATTGG -3'

Sequencing Primer
(F):5'- TCCCCAGCTGTACCAGGAATG -3'
(R):5'- CCATGATTGGTGGCCTCTG -3'

Posted On

2017-02-15