Incidental Mutation 'R5903:Kif5a'
ID 456455
Institutional Source Beutler Lab
Gene Symbol Kif5a
Ensembl Gene ENSMUSG00000074657
Gene Name kinesin family member 5A
Synonyms Khc, Kns, Kif5, D10Bwg0738e
MMRRC Submission 044101-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5903 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 127225696-127263348 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127230578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 990 (M990L)
Ref Sequence ENSEMBL: ENSMUSP00000151402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895]
AlphaFold P33175
Predicted Effect probably benign
Transcript: ENSMUST00000099172
AA Change: M990L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: M990L

DomainStartEndE-ValueType
KISc 7 335 7.38e-173 SMART
low complexity region 340 362 N/A INTRINSIC
coiled coil region 408 539 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
coiled coil region 632 800 N/A INTRINSIC
coiled coil region 822 905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217895
AA Change: M990L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Pdzd8 A G 19: 59,345,286 I101T possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Kif5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Kif5a APN 10 127239196 missense probably benign
IGL01405:Kif5a APN 10 127245990 missense probably damaging 1.00
IGL01637:Kif5a APN 10 127245368 missense possibly damaging 0.94
IGL01894:Kif5a APN 10 127262779 missense probably benign 0.04
IGL01978:Kif5a APN 10 127245739 missense probably benign
IGL02039:Kif5a APN 10 127233867 missense possibly damaging 0.95
IGL02052:Kif5a APN 10 127243499 missense probably damaging 1.00
IGL02336:Kif5a APN 10 127242696 missense possibly damaging 0.87
IGL02352:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02359:Kif5a APN 10 127243501 missense probably damaging 1.00
IGL02834:Kif5a APN 10 127245756 missense probably benign 0.00
IGL03101:Kif5a APN 10 127235609 unclassified probably benign
brittany UTSW 10 127248254 missense probably damaging 1.00
spaniel UTSW 10 127230578 missense probably benign 0.00
R0463:Kif5a UTSW 10 127235652 missense probably benign 0.00
R0790:Kif5a UTSW 10 127246009 intron probably benign
R1070:Kif5a UTSW 10 127245406 missense probably benign 0.00
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1404:Kif5a UTSW 10 127245442 missense probably benign 0.12
R1502:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R1812:Kif5a UTSW 10 127242010 missense probably benign 0.03
R1837:Kif5a UTSW 10 127236815 nonsense probably null
R1838:Kif5a UTSW 10 127236815 nonsense probably null
R2012:Kif5a UTSW 10 127239175 missense probably benign
R2072:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2073:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2074:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2075:Kif5a UTSW 10 127245369 missense probably damaging 0.99
R2440:Kif5a UTSW 10 127231336 missense probably benign 0.34
R3157:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R3688:Kif5a UTSW 10 127242774 missense probably damaging 1.00
R3740:Kif5a UTSW 10 127243468 missense probably damaging 1.00
R4782:Kif5a UTSW 10 127230954 missense probably benign 0.01
R5049:Kif5a UTSW 10 127239839 missense possibly damaging 0.93
R5723:Kif5a UTSW 10 127231029 frame shift probably null
R5764:Kif5a UTSW 10 127231029 frame shift probably null
R5838:Kif5a UTSW 10 127245441 missense probably damaging 1.00
R6299:Kif5a UTSW 10 127233821 missense probably damaging 1.00
R6384:Kif5a UTSW 10 127242775 missense probably damaging 1.00
R6629:Kif5a UTSW 10 127248254 missense probably damaging 1.00
R7463:Kif5a UTSW 10 127243724 missense probably damaging 0.97
R7558:Kif5a UTSW 10 127248079 missense probably damaging 1.00
R7567:Kif5a UTSW 10 127237379 missense probably benign 0.00
R7733:Kif5a UTSW 10 127236740 missense probably benign 0.00
R7853:Kif5a UTSW 10 127235668 nonsense probably null
R7869:Kif5a UTSW 10 127243474 missense probably damaging 1.00
R7896:Kif5a UTSW 10 127242004 missense probably benign
R8085:Kif5a UTSW 10 127239309 missense probably benign 0.00
R8426:Kif5a UTSW 10 127231489 missense probably damaging 0.99
R8750:Kif5a UTSW 10 127248040 missense probably damaging 1.00
R9206:Kif5a UTSW 10 127243358 critical splice donor site probably null
R9497:Kif5a UTSW 10 127243484 missense probably damaging 1.00
R9747:Kif5a UTSW 10 127238753 missense probably benign 0.00
Z1177:Kif5a UTSW 10 127229823 missense probably benign 0.00
Z1177:Kif5a UTSW 10 127236967 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTCCACATGAATCGTACC -3'
(R):5'- CTCCTTGTCGCCATGATTGG -3'

Sequencing Primer
(F):5'- TCCCCAGCTGTACCAGGAATG -3'
(R):5'- CCATGATTGGTGGCCTCTG -3'
Posted On 2017-02-15