Incidental Mutation 'R8441:Mcm3'
ID 654188
Institutional Source Beutler Lab
Gene Symbol Mcm3
Ensembl Gene ENSMUSG00000041859
Gene Name minichromosome maintenance complex component 3
Synonyms p1.m, Mcmd, P1
MMRRC Submission 067885-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8441 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 20873192-20890536 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20884690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000059192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053266]
AlphaFold P25206
Predicted Effect probably benign
Transcript: ENSMUST00000053266
AA Change: D271G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059192
Gene: ENSMUSG00000041859
AA Change: D271G

DomainStartEndE-ValueType
MCM 109 654 N/A SMART
AAA 337 490 1.92e-4 SMART
coiled coil region 655 693 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null or hypomorph alleles exhibit prenatal lethality. Fetal mice homozygous for a hypomorphic allele display anemia and replicative stress during fetal erythropoiesis. Mice heterozygous for null or hypomorph alleles display increased incidence of lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,087,574 (GRCm39) Y1064H possibly damaging Het
Ahrr T C 13: 74,362,182 (GRCm39) D567G probably benign Het
Aldh1b1 T A 4: 45,802,465 (GRCm39) M1K probably null Het
Ankrd12 A T 17: 66,349,546 (GRCm39) S96T probably benign Het
Arhgef10 A T 8: 15,041,237 (GRCm39) probably benign Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Cmpk2 G A 12: 26,527,204 (GRCm39) A398T probably benign Het
Cpn2 A G 16: 30,078,849 (GRCm39) L284P probably damaging Het
Cubn T C 2: 13,432,658 (GRCm39) D1221G probably damaging Het
Dnah7c A G 1: 46,572,398 (GRCm39) K957R probably damaging Het
Eif1ad2 T G 12: 87,786,384 (GRCm39) D98E probably benign Het
Flnb T A 14: 7,896,488 (GRCm38) V893E probably benign Het
Flrt3 C A 2: 140,502,546 (GRCm39) V361L probably benign Het
Fnta G A 8: 26,501,209 (GRCm39) R104* probably null Het
Ggt1 C T 10: 75,415,185 (GRCm39) T233I possibly damaging Het
Gpr37l1 A T 1: 135,094,875 (GRCm39) V123E probably damaging Het
Grpel1 A G 5: 36,622,556 (GRCm39) R7G probably benign Het
H2-M10.5 A T 17: 37,084,199 (GRCm39) I54L probably benign Het
Mapk8ip3 A T 17: 25,139,474 (GRCm39) probably benign Het
Naip6 A G 13: 100,422,265 (GRCm39) V1256A possibly damaging Het
Nipbl A G 15: 8,322,599 (GRCm39) V2604A probably benign Het
Nlrp1b T A 11: 71,073,204 (GRCm39) D213V probably damaging Het
Npbwr1 G A 1: 5,987,397 (GRCm39) A39V possibly damaging Het
Nr6a1 T C 2: 38,632,888 (GRCm39) D191G probably benign Het
Olfml1 T G 7: 107,166,977 (GRCm39) V2G probably benign Het
Or4k38 A T 2: 111,166,131 (GRCm39) Y97* probably null Het
Or5b105 T A 19: 13,080,020 (GRCm39) Y216F probably damaging Het
Otof T C 5: 30,538,200 (GRCm39) K1175E probably damaging Het
Pira13 C A 7: 3,826,301 (GRCm39) E231* probably null Het
Plekhg2 C T 7: 28,060,291 (GRCm39) V989I probably benign Het
Prkcq A G 2: 11,253,037 (GRCm39) D229G probably benign Het
Ptprf A T 4: 118,075,255 (GRCm39) probably benign Het
Rest G T 5: 77,429,766 (GRCm39) Q728H possibly damaging Het
Scube1 A T 15: 83,494,423 (GRCm39) I868N probably damaging Het
Spcs3 A G 8: 54,981,375 (GRCm39) probably null Het
Speg A G 1: 75,387,976 (GRCm39) S1445G possibly damaging Het
Spmap2 C A 10: 79,412,510 (GRCm39) R327L probably damaging Het
Tmem145 T C 7: 25,008,200 (GRCm39) F261S possibly damaging Het
Trav9d-4 A G 14: 53,221,284 (GRCm39) S93G probably benign Het
Trbv5 T A 6: 41,039,517 (GRCm39) C41S probably damaging Het
Trpm5 A G 7: 142,626,171 (GRCm39) S1131P possibly damaging Het
Ttc28 C T 5: 111,325,507 (GRCm39) R313* probably null Het
Ubap2l T C 3: 89,920,007 (GRCm39) T853A unknown Het
Xirp2 T C 2: 67,343,159 (GRCm39) V1800A possibly damaging Het
Zfhx2 A G 14: 55,303,985 (GRCm39) L1333P possibly damaging Het
Other mutations in Mcm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Mcm3 APN 1 20,875,039 (GRCm39) critical splice donor site probably null
IGL01061:Mcm3 APN 1 20,884,720 (GRCm39) missense possibly damaging 0.86
IGL01488:Mcm3 APN 1 20,883,280 (GRCm39) missense possibly damaging 0.90
IGL01609:Mcm3 APN 1 20,884,904 (GRCm39) splice site probably benign
IGL02483:Mcm3 APN 1 20,873,796 (GRCm39) missense possibly damaging 0.68
IGL02869:Mcm3 APN 1 20,879,063 (GRCm39) missense probably damaging 0.99
R0197:Mcm3 UTSW 1 20,880,329 (GRCm39) missense probably damaging 1.00
R0462:Mcm3 UTSW 1 20,875,556 (GRCm39) missense probably benign
R0467:Mcm3 UTSW 1 20,875,071 (GRCm39) missense probably benign
R0669:Mcm3 UTSW 1 20,875,153 (GRCm39) splice site probably null
R1251:Mcm3 UTSW 1 20,882,896 (GRCm39) nonsense probably null
R1599:Mcm3 UTSW 1 20,890,422 (GRCm39) missense probably benign 0.08
R1764:Mcm3 UTSW 1 20,876,103 (GRCm39) missense probably damaging 0.98
R2015:Mcm3 UTSW 1 20,873,804 (GRCm39) missense probably damaging 0.98
R2140:Mcm3 UTSW 1 20,883,334 (GRCm39) missense probably benign 0.00
R3033:Mcm3 UTSW 1 20,878,992 (GRCm39) missense probably damaging 1.00
R4430:Mcm3 UTSW 1 20,882,217 (GRCm39) nonsense probably null
R4513:Mcm3 UTSW 1 20,880,456 (GRCm39) missense probably damaging 1.00
R4563:Mcm3 UTSW 1 20,879,869 (GRCm39) missense probably benign
R4713:Mcm3 UTSW 1 20,873,801 (GRCm39) missense probably benign
R4801:Mcm3 UTSW 1 20,880,380 (GRCm39) missense probably damaging 0.99
R4802:Mcm3 UTSW 1 20,880,380 (GRCm39) missense probably damaging 0.99
R4896:Mcm3 UTSW 1 20,890,480 (GRCm39) utr 5 prime probably benign
R5035:Mcm3 UTSW 1 20,873,642 (GRCm39) utr 3 prime probably benign
R5461:Mcm3 UTSW 1 20,884,661 (GRCm39) missense probably benign 0.00
R5486:Mcm3 UTSW 1 20,885,118 (GRCm39) missense probably damaging 1.00
R5531:Mcm3 UTSW 1 20,873,768 (GRCm39) missense possibly damaging 0.46
R5759:Mcm3 UTSW 1 20,878,972 (GRCm39) frame shift probably null
R5760:Mcm3 UTSW 1 20,878,972 (GRCm39) frame shift probably null
R6505:Mcm3 UTSW 1 20,873,768 (GRCm39) missense probably damaging 1.00
R6833:Mcm3 UTSW 1 20,880,320 (GRCm39) missense possibly damaging 0.48
R6834:Mcm3 UTSW 1 20,880,320 (GRCm39) missense possibly damaging 0.48
R7179:Mcm3 UTSW 1 20,885,081 (GRCm39) missense probably damaging 0.98
R7514:Mcm3 UTSW 1 20,876,120 (GRCm39) missense probably benign 0.19
R7673:Mcm3 UTSW 1 20,882,238 (GRCm39) missense probably damaging 1.00
R7689:Mcm3 UTSW 1 20,876,997 (GRCm39) missense probably benign 0.29
R7718:Mcm3 UTSW 1 20,887,498 (GRCm39) nonsense probably null
R8411:Mcm3 UTSW 1 20,886,980 (GRCm39) missense probably benign 0.00
R8412:Mcm3 UTSW 1 20,886,980 (GRCm39) missense probably benign 0.00
R9265:Mcm3 UTSW 1 20,879,905 (GRCm39) missense probably damaging 0.98
R9325:Mcm3 UTSW 1 20,875,562 (GRCm39) missense probably benign 0.03
X0062:Mcm3 UTSW 1 20,890,361 (GRCm39) missense possibly damaging 0.49
Z1176:Mcm3 UTSW 1 20,890,405 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAGGTTCAACTGAGCAGCCC -3'
(R):5'- AACAGGCATTCCGTCCTCAC -3'

Sequencing Primer
(F):5'- GTTCAACTGAGCAGCCCAGAAG -3'
(R):5'- CTCACTGTGGCTGGTGGAC -3'
Posted On 2020-10-20