Incidental Mutation 'R8449:Wnt5a'
ID654679
Institutional Source Beutler Lab
Gene Symbol Wnt5a
Ensembl Gene ENSMUSG00000021994
Gene Namewingless-type MMTV integration site family, member 5A
Synonyms8030457G12Rik, Wnt-5a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8449 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location28504750-28527448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28513151 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 51 (M51V)
Ref Sequence ENSEMBL: ENSMUSP00000064878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063465] [ENSMUST00000112272]
Predicted Effect probably benign
Transcript: ENSMUST00000063465
AA Change: M51V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064878
Gene: ENSMUSG00000021994
AA Change: M51V

DomainStartEndE-ValueType
Blast:WNT1 1 46 7e-6 BLAST
WNT1 71 380 6.71e-222 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112272
AA Change: M31V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107891
Gene: ENSMUSG00000021994
AA Change: M31V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WNT1 51 360 6.71e-222 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants exhibit caudal truncation with shortened anterior-posterior axis, truncation of the snout, tongue and mandible, short fore- and hindlimbs, which lack digits, absent genital tubercle and lung abnormalities. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,994,942 E58G probably damaging Het
Ank1 T A 8: 23,139,286 F4I possibly damaging Het
Arih2 T C 9: 108,611,673 D282G possibly damaging Het
Atp7b C T 8: 22,013,540 V733I probably damaging Het
Avil A G 10: 127,009,992 D370G probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdkl3 A G 11: 52,084,433 H74R Het
Clec9a C A 6: 129,410,329 A49E probably damaging Het
Cntn5 A G 9: 9,666,835 probably null Het
Cyp11b2 A G 15: 74,851,579 M412T possibly damaging Het
Dync1i1 A G 6: 5,966,815 Q399R possibly damaging Het
Fam47e C A 5: 92,555,131 R21S probably benign Het
Gimap4 A G 6: 48,690,760 I150V probably damaging Het
Gm4756 T C 12: 72,612,566 N145D probably damaging Het
Gm7361 T A 5: 26,260,389 M128K possibly damaging Het
Gtf3c3 C T 1: 54,428,909 E190K probably damaging Het
Hells T C 19: 38,951,842 S396P probably damaging Het
Hrg T A 16: 22,961,536 S521R unknown Het
Itih5 A G 2: 10,186,989 T112A probably benign Het
Ly9 T A 1: 171,594,018 N555I probably damaging Het
Morc2b C T 17: 33,136,801 E666K probably benign Het
Mup8 C A 4: 60,222,382 V30L probably benign Het
Nebl T A 2: 17,413,782 E268D probably damaging Het
Nr4a3 G T 4: 48,052,170 R308L probably benign Het
Olfr1080 T G 2: 86,553,636 I163L probably benign Het
Olfr125 A G 17: 37,835,670 R224G probably damaging Het
Olfr1258 A T 2: 89,930,534 I242L possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Olfr370 A T 8: 83,541,672 H176L probably damaging Het
Plcd3 A G 11: 103,074,670 Y530H probably damaging Het
Pou2af1 A T 9: 51,233,026 E80V probably damaging Het
Scgb2b18 C T 7: 33,173,231 D50N probably benign Het
Shisa6 G C 11: 66,525,730 Q79E probably benign Het
Sis C T 3: 72,903,651 G1679D probably damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Ston2 T C 12: 91,641,875 D817G probably damaging Het
Ticrr T A 7: 79,694,680 F1431Y probably benign Het
Uevld T A 7: 46,945,307 N179I probably damaging Het
Utp6 G T 11: 79,945,784 Q375K probably benign Het
Vmn2r68 T A 7: 85,233,577 E322D probably damaging Het
Zfp202 A T 9: 40,207,680 R130* probably null Het
Zfp949 G T 9: 88,567,249 V36L possibly damaging Het
Other mutations in Wnt5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Wnt5a APN 14 28522909 missense probably damaging 1.00
IGL01945:Wnt5a APN 14 28518562 missense probably damaging 1.00
IGL02117:Wnt5a APN 14 28506120 splice site probably benign
IGL02995:Wnt5a APN 14 28522914 missense probably benign 0.02
IGL03123:Wnt5a APN 14 28522925 missense probably damaging 1.00
Thrush UTSW 14 28518463 missense possibly damaging 0.78
R0254:Wnt5a UTSW 14 28522854 missense probably damaging 1.00
R0277:Wnt5a UTSW 14 28513268 missense possibly damaging 0.74
R0365:Wnt5a UTSW 14 28518504 nonsense probably null
R1472:Wnt5a UTSW 14 28518504 nonsense probably null
R1661:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1662:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1762:Wnt5a UTSW 14 28522891 missense probably damaging 1.00
R1791:Wnt5a UTSW 14 28511878 start codon destroyed probably null 0.00
R1933:Wnt5a UTSW 14 28511845 missense probably benign 0.00
R2147:Wnt5a UTSW 14 28513317 missense probably damaging 1.00
R2149:Wnt5a UTSW 14 28513317 missense probably damaging 1.00
R3078:Wnt5a UTSW 14 28513183 nonsense probably null
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R4237:Wnt5a UTSW 14 28522866 missense probably damaging 1.00
R5396:Wnt5a UTSW 14 28522770 missense probably damaging 1.00
R6329:Wnt5a UTSW 14 28518492 nonsense probably null
R6698:Wnt5a UTSW 14 28518463 missense possibly damaging 0.78
R6974:Wnt5a UTSW 14 28522570 missense possibly damaging 0.89
R7114:Wnt5a UTSW 14 28522756 missense probably damaging 1.00
R7232:Wnt5a UTSW 14 28518372 missense probably benign 0.03
R7457:Wnt5a UTSW 14 28518279 splice site probably null
R7666:Wnt5a UTSW 14 28518372 missense possibly damaging 0.88
R8273:Wnt5a UTSW 14 28522605 missense probably damaging 1.00
R8349:Wnt5a UTSW 14 28513151 missense probably benign 0.00
T0722:Wnt5a UTSW 14 28511925 missense probably benign 0.01
Z1088:Wnt5a UTSW 14 28522728 missense probably damaging 0.99
Z1176:Wnt5a UTSW 14 28511907 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATACCTCTGTTTTCTGCAGGG -3'
(R):5'- TGCAGTTCCATCTCCGATGC -3'

Sequencing Primer
(F):5'- ACAGAGGAGTTCTATGAAGCCCTTC -3'
(R):5'- CCGGAACTGGTACTGGCATTC -3'
Posted On2020-10-20