Incidental Mutation 'R8449:Sorcs2'
ID 654653
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission 067829-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8449 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36386519 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 173 (M173K)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000070720] [ENSMUST00000135324]
AlphaFold Q9EPR5
Predicted Effect possibly damaging
Transcript: ENSMUST00000037370
AA Change: M173K

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: M173K

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070720
AA Change: M173K

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093
AA Change: M173K

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
Blast:VPS10 170 213 2e-22 BLAST
low complexity region 214 227 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135324
AA Change: M1K

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123543
Gene: ENSMUSG00000029093
AA Change: M1K

DomainStartEndE-ValueType
SCOP:d1eur__ 1 111 2e-3 SMART
Blast:VPS10 1 173 1e-126 BLAST
PDB:4N7E|A 6 117 1e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,885,768 (GRCm39) E58G probably damaging Het
Ank1 T A 8: 23,629,302 (GRCm39) F4I possibly damaging Het
Arih2 T C 9: 108,488,872 (GRCm39) D282G possibly damaging Het
Atp7b C T 8: 22,503,556 (GRCm39) V733I probably damaging Het
Avil A G 10: 126,845,861 (GRCm39) D370G probably benign Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Cdkl3 A G 11: 51,975,260 (GRCm39) H74R Het
Clec9a C A 6: 129,387,292 (GRCm39) A49E probably damaging Het
Cntn5 A G 9: 9,666,840 (GRCm39) probably null Het
Cyp11b2 A G 15: 74,723,428 (GRCm39) M412T possibly damaging Het
Dhrs7l T C 12: 72,659,340 (GRCm39) N145D probably damaging Het
Dync1i1 A G 6: 5,966,815 (GRCm39) Q399R possibly damaging Het
Fam47e C A 5: 92,702,990 (GRCm39) R21S probably benign Het
Gimap4 A G 6: 48,667,694 (GRCm39) I150V probably damaging Het
Gm7361 T A 5: 26,465,387 (GRCm39) M128K possibly damaging Het
Gtf3c3 C T 1: 54,468,068 (GRCm39) E190K probably damaging Het
Hells T C 19: 38,940,286 (GRCm39) S396P probably damaging Het
Hrg T A 16: 22,780,286 (GRCm39) S521R unknown Het
Itih5 A G 2: 10,191,800 (GRCm39) T112A probably benign Het
Ly9 T A 1: 171,421,586 (GRCm39) N555I probably damaging Het
Morc2b C T 17: 33,355,775 (GRCm39) E666K probably benign Het
Mup8 C A 4: 60,222,382 (GRCm39) V30L probably benign Het
Nebl T A 2: 17,418,593 (GRCm39) E268D probably damaging Het
Nr4a3 G T 4: 48,052,170 (GRCm39) R308L probably benign Het
Or10k2 A T 8: 84,268,301 (GRCm39) H176L probably damaging Het
Or14j1 A G 17: 38,146,561 (GRCm39) R224G probably damaging Het
Or4c10 A T 2: 89,760,878 (GRCm39) I242L possibly damaging Het
Or6d14 G T 6: 116,534,289 (GRCm39) R301L probably damaging Het
Or8k33 T G 2: 86,383,980 (GRCm39) I163L probably benign Het
Plcd3 A G 11: 102,965,496 (GRCm39) Y530H probably damaging Het
Pou2af1 A T 9: 51,144,326 (GRCm39) E80V probably damaging Het
Scgb2b18 C T 7: 32,872,656 (GRCm39) D50N probably benign Het
Shisa6 G C 11: 66,416,556 (GRCm39) Q79E probably benign Het
Sis C T 3: 72,810,984 (GRCm39) G1679D probably damaging Het
Ston2 T C 12: 91,608,649 (GRCm39) D817G probably damaging Het
Ticrr T A 7: 79,344,428 (GRCm39) F1431Y probably benign Het
Uevld T A 7: 46,595,055 (GRCm39) N179I probably damaging Het
Utp6 G T 11: 79,836,610 (GRCm39) Q375K probably benign Het
Vmn2r68 T A 7: 84,882,785 (GRCm39) E322D probably damaging Het
Wnt5a A G 14: 28,235,108 (GRCm39) M51V probably benign Het
Zfp202 A T 9: 40,118,976 (GRCm39) R130* probably null Het
Zfp949 G T 9: 88,449,302 (GRCm39) V36L possibly damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTCCAGCCACTGAGAAGCG -3'
(R):5'- AGTTGGGATGTCTCCAGAATC -3'

Sequencing Primer
(F):5'- ACTGAGAAGCGGTGGGCC -3'
(R):5'- TTTCCGAAGAAGAGACTAGGTCC -3'
Posted On 2020-10-20