Incidental Mutation 'R8453:Tmem115'
ID654866
Institutional Source Beutler Lab
Gene Symbol Tmem115
Ensembl Gene ENSMUSG00000010045
Gene Nametransmembrane protein 115
SynonymsPl6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R8453 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107533945-107538673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107534798 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 107 (V107A)
Ref Sequence ENSEMBL: ENSMUSP00000010189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010189] [ENSMUST00000041459] [ENSMUST00000195235]
Predicted Effect probably benign
Transcript: ENSMUST00000010189
AA Change: V107A

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010189
Gene: ENSMUSG00000010045
AA Change: V107A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
DUF1751 49 151 4.14e-41 SMART
transmembrane domain 164 183 N/A INTRINSIC
transmembrane domain 190 208 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Blast:DUF1751 304 347 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000041459
SMART Domains Protein: ENSMUSP00000044093
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194344
Predicted Effect probably benign
Transcript: ENSMUST00000195235
SMART Domains Protein: ENSMUSP00000141723
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A T 5: 90,566,501 R123S possibly damaging Het
8030462N17Rik T C 18: 77,673,908 E236G probably damaging Het
9630041A04Rik G T 9: 101,938,685 C23F possibly damaging Het
Adam29 T C 8: 55,873,161 H86R possibly damaging Het
Alas1 C T 9: 106,236,522 R508Q possibly damaging Het
Bmp3 G A 5: 98,855,423 probably null Het
Bud13 A G 9: 46,288,201 T287A probably benign Het
C3 T C 17: 57,212,643 E1203G probably benign Het
Carmil2 A C 8: 105,690,211 Q476P probably damaging Het
Ccdc187 T A 2: 26,276,446 T707S probably damaging Het
Cfap43 A T 19: 47,746,647 V1435E probably damaging Het
Chrm3 A T 13: 9,877,231 *590K probably null Het
Commd1 C T 11: 22,978,503 probably benign Het
Creb3l1 A T 2: 91,990,929 Y314* probably null Het
Ctc1 T A 11: 69,022,449 S90R probably benign Het
Dixdc1 T C 9: 50,684,886 Q413R probably benign Het
Dlg5 T C 14: 24,158,145 T998A probably benign Het
Fam89b A G 19: 5,728,875 S99P possibly damaging Het
Fbxo30 A G 10: 11,290,735 I400M probably benign Het
Gad1 A T 2: 70,600,713 M567L probably benign Het
Gemin5 T C 11: 58,125,239 S1314G probably benign Het
Gm2035 C T 12: 87,919,553 S102N probably benign Het
Gm9195 T G 14: 72,440,761 I2323L probably benign Het
Gria1 T A 11: 57,243,051 F585L probably damaging Het
Hbs1l A T 10: 21,309,279 H200L probably benign Het
Igsf5 A G 16: 96,421,796 Q360R probably benign Het
Il31ra A T 13: 112,524,183 V624E probably damaging Het
Iqsec3 T C 6: 121,387,820 R837G probably damaging Het
Lpl A G 8: 68,895,781 I221V probably damaging Het
Mcf2l T C 8: 12,984,956 probably null Het
Mink1 T A 11: 70,610,328 D887E possibly damaging Het
Mmp10 T G 9: 7,508,202 F443C probably damaging Het
Mmrn1 T A 6: 60,988,377 Y1131N probably damaging Het
Mrc2 T A 11: 105,332,311 V460E probably damaging Het
Nicn1 T A 9: 108,293,373 F57Y probably damaging Het
Nlrp4b A G 7: 10,715,601 Y577C probably damaging Het
Nrap T C 19: 56,323,920 T1535A probably damaging Het
Opa1 G A 16: 29,620,868 R755H probably damaging Het
Phldb2 A G 16: 45,825,022 S354P probably benign Het
Phykpl T C 11: 51,598,294 S316P probably damaging Het
Pnpla1 T A 17: 28,858,899 D11E probably benign Het
Pold2 A G 11: 5,875,104 F98L probably damaging Het
Prph G A 15: 99,056,776 R241Q probably benign Het
Rcl1 T C 19: 29,115,759 I58T possibly damaging Het
Rps6ka2 A G 17: 7,246,752 N117D probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Sars G A 3: 108,428,713 S331L probably benign Het
Scfd1 A C 12: 51,412,591 K312Q possibly damaging Het
Senp5 A G 16: 31,989,348 C363R probably benign Het
Senp7 A G 16: 56,188,328 I1024V probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sptbn4 A G 7: 27,404,238 L1191P probably damaging Het
Ssfa2 T C 2: 79,644,785 S363P probably benign Het
Stk40 A G 4: 126,128,973 E180G probably damaging Het
Stxbp5 A T 10: 9,809,048 V536E probably benign Het
Tex15 G T 8: 33,576,871 E2110* probably null Het
Thbs4 G A 13: 92,790,817 P55S probably benign Het
Tnfaip6 A C 2: 52,055,867 I242L probably benign Het
Trabd G T 15: 89,085,413 A270S possibly damaging Het
Trim30d T A 7: 104,487,740 I86F probably damaging Het
Trpc7 A G 13: 56,822,559 V404A probably benign Het
Vmn1r61 A G 7: 5,610,887 Y143H probably benign Het
Vmn2r18 T A 5: 151,561,908 D707V probably damaging Het
Vnn3 G A 10: 23,869,545 R464H probably benign Het
Wdr27 T C 17: 14,892,489 T652A probably benign Het
Wdr78 A G 4: 103,059,916 I577T possibly damaging Het
Yeats2 C T 16: 20,222,887 R1176* probably null Het
Other mutations in Tmem115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Tmem115 APN 9 107534582 missense probably damaging 1.00
IGL01142:Tmem115 APN 9 107534645 missense possibly damaging 0.94
IGL01386:Tmem115 APN 9 107534660 missense probably damaging 1.00
IGL01705:Tmem115 APN 9 107535204 missense probably benign 0.44
R0746:Tmem115 UTSW 9 107537999 missense probably benign 0.11
R1511:Tmem115 UTSW 9 107534975 missense probably benign 0.04
R4182:Tmem115 UTSW 9 107535283 missense probably damaging 1.00
R4770:Tmem115 UTSW 9 107534957 missense probably benign 0.43
R5097:Tmem115 UTSW 9 107534860 missense probably benign 0.03
R5141:Tmem115 UTSW 9 107537942 missense probably benign 0.01
R5687:Tmem115 UTSW 9 107534855 missense probably benign 0.17
R7145:Tmem115 UTSW 9 107535086 missense probably benign 0.30
R8299:Tmem115 UTSW 9 107534546 missense possibly damaging 0.94
R8353:Tmem115 UTSW 9 107534798 missense probably benign 0.44
X0067:Tmem115 UTSW 9 107534513 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTCCTTCGCTGTGGACACG -3'
(R):5'- ACTGGATAGCAGCCCAAAG -3'

Sequencing Primer
(F):5'- CTGTGGACACGGGCTGC -3'
(R):5'- CATGGGAACGACGCTGAC -3'
Posted On2020-10-20