Incidental Mutation 'R4182:Tmem115'
ID319783
Institutional Source Beutler Lab
Gene Symbol Tmem115
Ensembl Gene ENSMUSG00000010045
Gene Nametransmembrane protein 115
SynonymsPl6
MMRRC Submission 041018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R4182 (G1)
Quality Score219
Status Validated
Chromosome9
Chromosomal Location107533945-107538673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107535283 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 269 (T269A)
Ref Sequence ENSEMBL: ENSMUSP00000010189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010189] [ENSMUST00000041459] [ENSMUST00000194967] [ENSMUST00000195235]
Predicted Effect probably damaging
Transcript: ENSMUST00000010189
AA Change: T269A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010189
Gene: ENSMUSG00000010045
AA Change: T269A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
DUF1751 49 151 4.14e-41 SMART
transmembrane domain 164 183 N/A INTRINSIC
transmembrane domain 190 208 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Blast:DUF1751 304 347 2e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000041459
SMART Domains Protein: ENSMUSP00000044093
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194906
Predicted Effect probably benign
Transcript: ENSMUST00000194967
Predicted Effect probably benign
Transcript: ENSMUST00000195235
SMART Domains Protein: ENSMUSP00000141723
Gene: ENSMUSG00000037190

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
B561 47 178 8.01e-42 SMART
transmembrane domain 189 211 N/A INTRINSIC
Meta Mutation Damage Score 0.1931 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Baz2b A T 2: 60,098,457 probably benign Het
Bcl9 A G 3: 97,213,683 probably null Het
Cfap20 A T 8: 95,424,656 I19N probably damaging Het
Clnk T A 5: 38,747,850 probably benign Het
Col18a1 C T 10: 77,058,841 probably null Het
Cux2 C T 5: 121,868,492 G905D probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Ddx59 T A 1: 136,439,861 S569T probably benign Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnajc21 T C 15: 10,459,933 probably null Het
Fam217a T C 13: 34,910,256 T416A possibly damaging Het
Gbp9 T A 5: 105,083,595 Q375L probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
H2-T24 A T 17: 36,015,484 N174K possibly damaging Het
Heatr3 T C 8: 88,171,002 probably benign Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Naaa C T 5: 92,272,554 probably null Het
Nbea A G 3: 56,008,427 C875R probably damaging Het
Nme1 G A 11: 93,960,804 T87I probably benign Het
Nphp3 T C 9: 104,038,464 S124P probably benign Het
Nrap C T 19: 56,350,327 V907M probably damaging Het
Olfr1312 G T 2: 112,042,528 P168Q probably damaging Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhga8 A G 18: 37,727,283 N464S probably damaging Het
Pdcd6ip T C 9: 113,700,010 I75V probably benign Het
Ralgapa2 G A 2: 146,435,994 P416S probably damaging Het
Saal1 A G 7: 46,710,652 probably benign Het
Susd5 A G 9: 114,095,985 E312G probably benign Het
Tgfb2 T A 1: 186,629,025 D315V possibly damaging Het
Tll1 C T 8: 64,041,511 D737N probably damaging Het
Ttc39b T C 4: 83,237,301 D490G probably damaging Het
Vmn1r72 C T 7: 11,670,068 R151K probably benign Het
Vmn2r74 A T 7: 85,957,187 F317Y possibly damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zfp560 A G 9: 20,347,448 I706T probably benign Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Tmem115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Tmem115 APN 9 107534582 missense probably damaging 1.00
IGL01142:Tmem115 APN 9 107534645 missense possibly damaging 0.94
IGL01386:Tmem115 APN 9 107534660 missense probably damaging 1.00
IGL01705:Tmem115 APN 9 107535204 missense probably benign 0.44
R0746:Tmem115 UTSW 9 107537999 missense probably benign 0.11
R1511:Tmem115 UTSW 9 107534975 missense probably benign 0.04
R4770:Tmem115 UTSW 9 107534957 missense probably benign 0.43
R5097:Tmem115 UTSW 9 107534860 missense probably benign 0.03
R5141:Tmem115 UTSW 9 107537942 missense probably benign 0.01
R5687:Tmem115 UTSW 9 107534855 missense probably benign 0.17
R7145:Tmem115 UTSW 9 107535086 missense probably benign 0.30
R8299:Tmem115 UTSW 9 107534546 missense possibly damaging 0.94
R8353:Tmem115 UTSW 9 107534798 missense probably benign 0.44
R8453:Tmem115 UTSW 9 107534798 missense probably benign 0.44
X0067:Tmem115 UTSW 9 107534513 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTATCAGCGCCATAGCCG -3'
(R):5'- ACCTACACATTCAGTTCCCTCGAG -3'

Sequencing Primer
(F):5'- CATAGCCGGGGCCGAGG -3'
(R):5'- ATTCAGTTCCCTCGAGGCCAAG -3'
Posted On2015-06-10