Mutagenetix > Incidental Mutation

Incidental Mutation 'R8453:Mink1'

654878

Institutional Source

Beutler Lab

Gene Symbol

Mink1

Ensembl Gene

ENSMUSG00000020827

Gene Name

misshapen-like kinase 1 (zebrafish)

Synonyms

Map4k6, Ysk2, MINK, Misshapen/NIKs-related kinase

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8453 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70562881-70614483 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70610328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 887 (D887E)

Ref Sequence

ENSEMBL: ENSMUSP00000099619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014753] [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102556] [ENSMUST00000102558] [ENSMUST00000102559]

AlphaFold

Q9JM52

Predicted Effect

probably benign
Transcript: ENSMUST00000014753

SMART Domains

Protein: ENSMUSP00000014753
Gene: ENSMUSG00000014609

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Neur_chan_LBD	24	240	2.9e-65	PFAM
Pfam:Neur_chan_memb	247	475	6.5e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000072237
AA Change: D923E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827
AA Change: D923E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	837	874	N/A	INTRINSIC
CNH	1026	1324	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072873
AA Change: D916E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827
AA Change: D916E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	719	738	N/A	INTRINSIC
low complexity region	829	853	N/A	INTRINSIC
CNH	1019	1317	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079244
AA Change: D913E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827
AA Change: D913E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	314	338	N/A	INTRINSIC
coiled coil region	348	493	N/A	INTRINSIC
low complexity region	554	566	N/A	INTRINSIC
low complexity region	617	630	N/A	INTRINSIC
low complexity region	643	656	N/A	INTRINSIC
low complexity region	716	735	N/A	INTRINSIC
low complexity region	826	850	N/A	INTRINSIC
CNH	1016	1314	1.58e-113	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102556

SMART Domains

Protein: ENSMUSP00000099616
Gene: ENSMUSG00000014609

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Neur_chan_LBD	24	240	5.4e-65	PFAM
Pfam:Neur_chan_memb	247	474	2.9e-53	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102558
AA Change: D879E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827
AA Change: D879E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	792	816	N/A	INTRINSIC
CNH	982	1280	1.58e-113	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102559
AA Change: D887E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827
AA Change: D887E

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.86e-91	SMART
low complexity region	307	338	N/A	INTRINSIC
coiled coil region	351	496	N/A	INTRINSIC
low complexity region	557	569	N/A	INTRINSIC
low complexity region	620	633	N/A	INTRINSIC
low complexity region	646	659	N/A	INTRINSIC
low complexity region	800	824	N/A	INTRINSIC
CNH	990	1288	1.58e-113	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827
AA Change: D776E

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	1	140	2.3e-22	PFAM
Pfam:Pkinase	1	143	1.6e-30	PFAM
low complexity region	161	192	N/A	INTRINSIC
coiled coil region	204	349	N/A	INTRINSIC
low complexity region	411	423	N/A	INTRINSIC
low complexity region	474	487	N/A	INTRINSIC
low complexity region	500	513	N/A	INTRINSIC
low complexity region	573	592	N/A	INTRINSIC
low complexity region	691	728	N/A	INTRINSIC
CNH	880	1178	1.58e-113	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149845

Predicted Effect

probably benign
Transcript: ENSMUST00000178764

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	A	T	5: 90,566,501	R123S	possibly damaging	Het
8030462N17Rik	T	C	18: 77,673,908	E236G	probably damaging	Het
9630041A04Rik	G	T	9: 101,938,685	C23F	possibly damaging	Het
Adam29	T	C	8: 55,873,161	H86R	possibly damaging	Het
Alas1	C	T	9: 106,236,522	R508Q	possibly damaging	Het
Bmp3	G	A	5: 98,855,423		probably null	Het
Bud13	A	G	9: 46,288,201	T287A	probably benign	Het
C3	T	C	17: 57,212,643	E1203G	probably benign	Het
Carmil2	A	C	8: 105,690,211	Q476P	probably damaging	Het
Ccdc187	T	A	2: 26,276,446	T707S	probably damaging	Het
Cfap43	A	T	19: 47,746,647	V1435E	probably damaging	Het
Chrm3	A	T	13: 9,877,231	*590K	probably null	Het
Commd1	C	T	11: 22,978,503		probably benign	Het
Creb3l1	A	T	2: 91,990,929	Y314*	probably null	Het
Ctc1	T	A	11: 69,022,449	S90R	probably benign	Het
Dixdc1	T	C	9: 50,684,886	Q413R	probably benign	Het
Dlg5	T	C	14: 24,158,145	T998A	probably benign	Het
Fam89b	A	G	19: 5,728,875	S99P	possibly damaging	Het
Fbxo30	A	G	10: 11,290,735	I400M	probably benign	Het
Gad1	A	T	2: 70,600,713	M567L	probably benign	Het
Gemin5	T	C	11: 58,125,239	S1314G	probably benign	Het
Gm2035	C	T	12: 87,919,553	S102N	probably benign	Het
Gm9195	T	G	14: 72,440,761	I2323L	probably benign	Het
Gria1	T	A	11: 57,243,051	F585L	probably damaging	Het
Hbs1l	A	T	10: 21,309,279	H200L	probably benign	Het
Igsf5	A	G	16: 96,421,796	Q360R	probably benign	Het
Il31ra	A	T	13: 112,524,183	V624E	probably damaging	Het
Iqsec3	T	C	6: 121,387,820	R837G	probably damaging	Het
Lpl	A	G	8: 68,895,781	I221V	probably damaging	Het
Mcf2l	T	C	8: 12,984,956		probably null	Het
Mmp10	T	G	9: 7,508,202	F443C	probably damaging	Het
Mmrn1	T	A	6: 60,988,377	Y1131N	probably damaging	Het
Mrc2	T	A	11: 105,332,311	V460E	probably damaging	Het
Nicn1	T	A	9: 108,293,373	F57Y	probably damaging	Het
Nlrp4b	A	G	7: 10,715,601	Y577C	probably damaging	Het
Nrap	T	C	19: 56,323,920	T1535A	probably damaging	Het
Opa1	G	A	16: 29,620,868	R755H	probably damaging	Het
P4htm	C	T	9: 108,580,367		probably benign	Het
Phldb2	A	G	16: 45,825,022	S354P	probably benign	Het
Phykpl	T	C	11: 51,598,294	S316P	probably damaging	Het
Pnpla1	T	A	17: 28,858,899	D11E	probably benign	Het
Pold2	A	G	11: 5,875,104	F98L	probably damaging	Het
Prph	G	A	15: 99,056,776	R241Q	probably benign	Het
Rcl1	T	C	19: 29,115,759	I58T	possibly damaging	Het
Rps6ka2	A	G	17: 7,246,752	N117D	probably benign	Het
Sars	G	A	3: 108,428,713	S331L	probably benign	Het
Scfd1	A	C	12: 51,412,591	K312Q	possibly damaging	Het
Senp5	A	G	16: 31,989,348	C363R	probably benign	Het
Senp7	A	G	16: 56,188,328	I1024V	probably damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sptbn4	A	G	7: 27,404,238	L1191P	probably damaging	Het
Ssfa2	T	C	2: 79,644,785	S363P	probably benign	Het
Stk40	A	G	4: 126,128,973	E180G	probably damaging	Het
Stxbp5	A	T	10: 9,809,048	V536E	probably benign	Het
Suco	A	T	1: 161,823,017		probably benign	Het
Tex15	G	T	8: 33,576,871	E2110*	probably null	Het
Thbs4	G	A	13: 92,790,817	P55S	probably benign	Het
Tmem115	T	C	9: 107,534,798	V107A	probably benign	Het
Tnfaip6	A	C	2: 52,055,867	I242L	probably benign	Het
Trabd	G	T	15: 89,085,413	A270S	possibly damaging	Het
Trim30d	T	A	7: 104,487,740	I86F	probably damaging	Het
Trpc7	A	G	13: 56,822,559	V404A	probably benign	Het
Vmn1r61	A	G	7: 5,610,887	Y143H	probably benign	Het
Vmn2r18	T	A	5: 151,561,908	D707V	probably damaging	Het
Vnn3	G	A	10: 23,869,545	R464H	probably benign	Het
Wdr27	T	C	17: 14,892,489	T652A	probably benign	Het
Wdr78	A	G	4: 103,059,916	I577T	possibly damaging	Het
Yeats2	C	T	16: 20,222,887	R1176*	probably null	Het

Other mutations in Mink1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Mink1	APN	11	70603812	missense	probably damaging	0.99
IGL00709:Mink1	APN	11	70613019	missense	probably damaging	0.99
IGL01064:Mink1	APN	11	70603481	missense	probably benign	0.05
IGL02612:Mink1	APN	11	70597226	missense	probably damaging	1.00
IGL02797:Mink1	APN	11	70610350	missense	probably damaging	1.00
IGL03056:Mink1	APN	11	70612583	critical splice donor site	probably null
IGL03066:Mink1	APN	11	70608889	missense	probably benign	0.01
IGL03185:Mink1	APN	11	70603860	missense	probably damaging	1.00
PIT4498001:Mink1	UTSW	11	70598888	missense	probably benign	0.05
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0025:Mink1	UTSW	11	70613042	missense	probably damaging	1.00
R0488:Mink1	UTSW	11	70597204	missense	probably damaging	1.00
R0637:Mink1	UTSW	11	70601676	missense	probably damaging	0.96
R0828:Mink1	UTSW	11	70610145	nonsense	probably null
R1081:Mink1	UTSW	11	70607035	missense	probably benign	0.07
R1175:Mink1	UTSW	11	70611340	missense	probably benign	0.02
R1441:Mink1	UTSW	11	70607114	missense	possibly damaging	0.72
R1532:Mink1	UTSW	11	70602007	missense	probably null	1.00
R1545:Mink1	UTSW	11	70598891	missense	possibly damaging	0.60
R1634:Mink1	UTSW	11	70608880	missense	probably benign	0.00
R1932:Mink1	UTSW	11	70608428	critical splice donor site	probably null
R2033:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R2184:Mink1	UTSW	11	70603797	missense	probably damaging	1.00
R2267:Mink1	UTSW	11	70601724	splice site	probably null
R2268:Mink1	UTSW	11	70601724	splice site	probably null
R2859:Mink1	UTSW	11	70612508	missense	probably damaging	1.00
R3713:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3714:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3715:Mink1	UTSW	11	70608950	missense	possibly damaging	0.93
R3716:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R3717:Mink1	UTSW	11	70607761	missense	probably damaging	0.98
R4607:Mink1	UTSW	11	70606067	missense	possibly damaging	0.72
R4735:Mink1	UTSW	11	70609260	splice site	probably null
R4790:Mink1	UTSW	11	70599041	missense	probably damaging	0.99
R4847:Mink1	UTSW	11	70602028	missense	probably damaging	1.00
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R4860:Mink1	UTSW	11	70611592	missense	probably damaging	0.98
R5081:Mink1	UTSW	11	70605144	missense	probably damaging	0.98
R5310:Mink1	UTSW	11	70607343	missense	probably benign	0.33
R5677:Mink1	UTSW	11	70605165	missense	possibly damaging	0.66
R5767:Mink1	UTSW	11	70606075	missense	possibly damaging	0.53
R5795:Mink1	UTSW	11	70607790	missense	possibly damaging	0.86
R5888:Mink1	UTSW	11	70610059	unclassified	probably benign
R5950:Mink1	UTSW	11	70609586	missense	possibly damaging	0.81
R6024:Mink1	UTSW	11	70599089	missense	possibly damaging	0.71
R6034:Mink1	UTSW	11	70607040	small deletion	probably benign
R6034:Mink1	UTSW	11	70607040	small deletion	probably benign
R6058:Mink1	UTSW	11	70611720	missense	possibly damaging	0.96
R6144:Mink1	UTSW	11	70610652	missense	possibly damaging	0.66
R6154:Mink1	UTSW	11	70610101	missense	possibly damaging	0.46
R6218:Mink1	UTSW	11	70598894	missense	possibly damaging	0.94
R6262:Mink1	UTSW	11	70603325	splice site	probably null
R6269:Mink1	UTSW	11	70598987	missense	probably damaging	1.00
R6273:Mink1	UTSW	11	70611435	nonsense	probably null
R6301:Mink1	UTSW	11	70612294	missense	possibly damaging	0.71
R6603:Mink1	UTSW	11	70609593	missense	probably damaging	0.96
R6876:Mink1	UTSW	11	70607435	missense	probably benign	0.02
R7030:Mink1	UTSW	11	70607775	missense	possibly damaging	0.46
R7050:Mink1	UTSW	11	70612332	missense	possibly damaging	0.93
R7094:Mink1	UTSW	11	70610075	splice site	probably null
R7135:Mink1	UTSW	11	70603503	missense	probably damaging	1.00
R7238:Mink1	UTSW	11	70611479	critical splice donor site	probably null
R7320:Mink1	UTSW	11	70599073	missense	probably benign	0.23
R7396:Mink1	UTSW	11	70605168	missense	possibly damaging	0.73
R7446:Mink1	UTSW	11	70609629	missense	probably benign	0.18
R7723:Mink1	UTSW	11	70612910	missense	probably benign	0.16
R7896:Mink1	UTSW	11	70612282	missense	possibly damaging	0.71
R8058:Mink1	UTSW	11	70603768	nonsense	probably null
R8082:Mink1	UTSW	11	70613277	missense	possibly damaging	0.71
R8160:Mink1	UTSW	11	70606081	nonsense	probably null
R8335:Mink1	UTSW	11	70609575	missense	probably damaging	0.97
R8353:Mink1	UTSW	11	70610328	missense	possibly damaging	0.70
R8732:Mink1	UTSW	11	70610076	critical splice acceptor site	probably null
R9072:Mink1	UTSW	11	70608381	missense	possibly damaging	0.86
R9073:Mink1	UTSW	11	70608381	missense	possibly damaging	0.86
R9324:Mink1	UTSW	11	70611651	missense	probably damaging	0.98
R9596:Mink1	UTSW	11	70607089	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGTTGAGGAGATATCCGGGAC -3'
(R):5'- CAGGTTCCTGTTAAGGTCACAG -3'

Sequencing Primer
(F):5'- AGATATCCGGGACCCAGC -3'
(R):5'- TGTTAAGGTCACAGTACCTTGC -3'

Posted On

2020-10-20