Incidental Mutation 'R8348:Vegfb'
ID660468
Institutional Source Beutler Lab
Gene Symbol Vegfb
Ensembl Gene ENSMUSG00000024962
Gene Namevascular endothelial growth factor B
SynonymsVrf, VEGF-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8348 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6982473-6987651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6985488 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 140 (I140V)
Ref Sequence ENSEMBL: ENSMUSP00000120860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025914] [ENSMUST00000025915] [ENSMUST00000130048] [ENSMUST00000179118]
Predicted Effect silent
Transcript: ENSMUST00000025914
SMART Domains Protein: ENSMUSP00000025914
Gene: ENSMUSG00000024962

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
low complexity region 182 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025915
SMART Domains Protein: ENSMUSP00000025915
Gene: ENSMUSG00000024963

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 160 179 N/A INTRINSIC
low complexity region 205 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130048
AA Change: I140V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120860
Gene: ENSMUSG00000024962
AA Change: I140V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDGF 45 126 1.11e-44 SMART
Pfam:VEGF_C 134 188 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179118
SMART Domains Protein: ENSMUSP00000136062
Gene: ENSMUSG00000024963

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
DnaJ 36 94 9.97e-23 SMART
transmembrane domain 159 178 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for one or more disruptions in this gene display defective cardiac morphology and physiology, sensitivity to induced neurodegeneration, increased weight and brown adipose whitening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik A G 7: 38,194,960 Y139C possibly damaging Het
A430033K04Rik A G 5: 138,636,252 D43G probably damaging Het
Actn3 C A 19: 4,865,333 V464L possibly damaging Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Arhgef28 G T 13: 98,053,867 P195T possibly damaging Het
Axdnd1 A T 1: 156,418,284 D107E probably benign Het
C77080 G A 4: 129,223,906 R322C probably damaging Het
Cdh23 C T 10: 60,331,728 V1828M probably benign Het
Cep95 A G 11: 106,813,767 T440A possibly damaging Het
Ctdp1 G A 18: 80,450,110 A390V probably benign Het
Desi2 T A 1: 178,256,340 probably benign Het
Dnah2 A T 11: 69,429,447 M3932K possibly damaging Het
Dnah8 A T 17: 30,736,147 Q2050L probably damaging Het
Etnppl T A 3: 130,629,492 M274K probably benign Het
Farp2 G T 1: 93,576,892 probably null Het
Fbxo46 G A 7: 19,136,544 G363R probably damaging Het
Fiz1 A G 7: 5,012,910 V27A probably benign Het
Fndc3b T A 3: 27,439,995 M994L probably benign Het
G3bp1 T G 11: 55,498,631 D384E possibly damaging Het
Galnt2 C T 8: 124,334,286 R306* probably null Het
Gle1 T C 2: 29,942,544 Y304H possibly damaging Het
Gm3415 G A 5: 146,556,597 R84H probably benign Het
Gm7694 A C 1: 170,301,640 S107A possibly damaging Het
Gpc6 A G 14: 117,435,820 D163G probably damaging Het
Gtpbp6 G A 5: 110,104,026 H514Y possibly damaging Het
Hdgfl2 A G 17: 56,099,370 E595G possibly damaging Het
Hoxc11 G A 15: 102,954,751 G76S possibly damaging Het
Hoxc4 T C 15: 103,035,014 C98R possibly damaging Het
Hydin A T 8: 110,603,246 I4871F possibly damaging Het
Ifnar1 A G 16: 91,495,299 D176G probably benign Het
Inafm1 A G 7: 16,273,130 I54T probably damaging Het
Inpp5b G A 4: 124,785,174 G458D probably damaging Het
Irs2 A T 8: 11,004,974 S1153T probably damaging Het
Kcnj15 A G 16: 95,295,750 Y77C probably damaging Het
Klhl35 C A 7: 99,471,855 D10E probably damaging Het
Lef1 A T 3: 131,112,812 M1L probably benign Het
Lima1 T C 15: 99,780,872 T403A probably benign Het
Magi3 T A 3: 104,051,215 N518I probably damaging Het
Mcoln3 T C 3: 146,131,219 C269R probably damaging Het
Mis18a A T 16: 90,727,031 L81* probably null Het
Mug2 A T 6: 122,072,233 K903* probably null Het
Pex6 T C 17: 46,723,113 S656P probably benign Het
Pgr C A 9: 8,922,601 Q591K probably benign Het
Phactr3 T C 2: 178,256,142 S50P probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Sipa1l1 T A 12: 82,396,271 N778K probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slc5a7 A G 17: 54,276,627 V545A possibly damaging Het
Snf8 A G 11: 96,035,051 K13R probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Tacc2 A C 7: 130,623,289 K568T possibly damaging Het
Tnxb C A 17: 34,710,128 T2715K possibly damaging Het
Vmn2r89 A C 14: 51,455,091 D117A possibly damaging Het
Vps13c C T 9: 67,879,103 T284I possibly damaging Het
Wnk1 T C 6: 119,929,999 probably null Het
Wscd2 T A 5: 113,572,310 H298Q possibly damaging Het
Zfp69 A T 4: 120,930,637 C494S probably damaging Het
Zfp715 T C 7: 43,299,937 T200A possibly damaging Het
Other mutations in Vegfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Vegfb APN 19 6986478 missense probably damaging 1.00
IGL02365:Vegfb APN 19 6985487 missense probably benign 0.19
IGL02431:Vegfb APN 19 6986018 splice site probably null
R2040:Vegfb UTSW 19 6986039 missense possibly damaging 0.93
R2312:Vegfb UTSW 19 6985427 missense possibly damaging 0.63
R3777:Vegfb UTSW 19 6987399 unclassified probably benign
R4152:Vegfb UTSW 19 6986078 missense probably damaging 1.00
R4154:Vegfb UTSW 19 6986078 missense probably damaging 1.00
R5635:Vegfb UTSW 19 6982846 makesense probably null
R7804:Vegfb UTSW 19 6986339 missense probably damaging 1.00
R8673:Vegfb UTSW 19 6985444 missense unknown
Predicted Primers PCR Primer
(F):5'- GACATAACCTTGCGGCCTTC -3'
(R):5'- AGTGCTGTGAAGCCAGACAG -3'

Sequencing Primer
(F):5'- TGCGGCCTTCTCACACAAG -3'
(R):5'- AAGCCAGACAGGTGAGTTTTTG -3'
Posted On2021-01-18