Mutagenetix > Incidental Mutation

Incidental Mutation 'R8733:Serac1'

662887

Institutional Source

Beutler Lab

Gene Symbol

Serac1

Ensembl Gene

ENSMUSG00000015659

Gene Name

serine active site containing 1

Synonyms

4930511N22Rik, D17Ertd141e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8733 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6042196-6079741 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6050028 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 479 (L479P)

Ref Sequence

ENSEMBL: ENSMUSP00000095043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000097432]

AlphaFold

Q3U213

Predicted Effect

probably damaging
Transcript: ENSMUST00000024570
AA Change: L449P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659
AA Change: L449P

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
low complexity region	161	169	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
SCOP:d1jdha_	243	336	3e-5	SMART
Pfam:PGAP1	360	519	3.4e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000097432
AA Change: L479P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659
AA Change: L479P

Domain	Start	End	E-Value	Type
transmembrane domain	32	54	N/A	INTRINSIC
SCOP:d1gw5a_	89	464	3e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,358,801	L1106P	probably damaging	Het
Alx3	C	G	3: 107,604,819	P258A	probably damaging	Het
Bbs9	A	G	9: 22,670,832	T607A	probably benign	Het
Catsperg1	A	T	7: 29,191,686	V644E	possibly damaging	Het
Cep85	T	C	4: 134,148,161	K499E	possibly damaging	Het
Chd5	A	T	4: 152,379,466	H1464L	probably damaging	Het
Chrne	A	G	11: 70,617,030	L281P	probably damaging	Het
Col3a1	A	G	1: 45,340,312		probably benign	Het
Cpsf4l	A	G	11: 113,709,453	F13L	possibly damaging	Het
Dgcr8	T	C	16: 18,259,961	I603V	probably benign	Het
Dhx16	A	G	17: 35,881,375	D102G	probably benign	Het
Dnm1	G	T	2: 32,316,975	D564E	probably benign	Het
Dync1li1	T	A	9: 114,705,110	Y93N	probably damaging	Het
Esp31	A	G	17: 38,644,618	I51V	probably benign	Het
Grap	G	T	11: 61,671,691	A163S	possibly damaging	Het
Hgs	G	A	11: 120,470,128		probably null	Het
Icosl	A	T	10: 78,073,863	N214I	probably damaging	Het
Ints6	G	A	14: 62,696,848	P737S	probably benign	Het
Lima1	A	G	15: 99,780,818	S581P	probably damaging	Het
Lrfn2	G	A	17: 49,096,796	R649H	probably damaging	Het
Mrvi1	C	T	7: 110,878,218	V564M	probably benign	Het
Muc5b	A	G	7: 141,863,795	T3493A	possibly damaging	Het
Mup4	A	T	4: 59,958,587	N104K	probably damaging	Het
Nedd4	T	C	9: 72,726,484	V424A	possibly damaging	Het
Olfr1117-ps1	A	T	2: 87,284,772	I161F	probably benign	Het
Olfr794	T	A	10: 129,570,710	D18E	possibly damaging	Het
Olfr930	A	G	9: 38,930,689	I173V	probably benign	Het
Otop1	G	A	5: 38,299,773	R292H	probably damaging	Het
Otop1	T	A	5: 38,300,453	C518*	probably null	Het
Parp3	C	T	9: 106,475,951	V9M	probably benign	Het
Pcdhb20	C	T	18: 37,505,384	A321V	probably damaging	Het
Pik3c2g	C	T	6: 139,768,700	Q311*	probably null	Het
Pkd1l1	A	T	11: 8,933,657	V855D		Het
Polr2k	T	A	15: 36,176,767	D97E	probably benign	Het
Psmd11	A	G	11: 80,434,516		probably benign	Het
Ralgapa2	G	A	2: 146,424,763	T631M	probably damaging	Het
Ralgps1	C	A	2: 33,284,824		probably null	Het
Rbm18	A	G	2: 36,134,199	S17P	probably damaging	Het
Rcc1	C	A	4: 132,338,204	L49F	probably benign	Het
Rgma	T	C	7: 73,409,288	S63P	possibly damaging	Het
Scn1a	T	A	2: 66,324,600	I672L	probably benign	Het
Sema4c	T	C	1: 36,552,873	T270A	probably damaging	Het
Slc22a16	A	G	10: 40,574,065	M187V	probably benign	Het
Slc41a3	A	T	6: 90,633,728	T191S	possibly damaging	Het
Slu7	G	A	11: 43,443,340	V398M	probably damaging	Het
Sphk1	A	G	11: 116,535,625	T136A	probably benign	Het
Sqstm1	G	T	11: 50,210,666	P31Q	possibly damaging	Het
Trappc11	A	T	8: 47,501,848	V885D	probably damaging	Het
Trav6-1	T	A	14: 52,638,756	Y44*	probably null	Het
Trav9-2	T	A	14: 53,591,298	C42S	probably damaging	Het
Zc2hc1a	A	G	3: 7,528,108	T194A	probably benign	Het
Zfp729a	A	G	13: 67,620,985	V375A	probably damaging	Het

Other mutations in Serac1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Serac1	APN	17	6074253	splice site	probably benign
IGL02642:Serac1	APN	17	6045746	missense	possibly damaging	0.56
IGL02972:Serac1	APN	17	6070764	nonsense	probably null
FR4304:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4340:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4342:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
FR4589:Serac1	UTSW	17	6070808	missense	probably damaging	1.00
PIT4480001:Serac1	UTSW	17	6050812	missense	probably damaging	1.00
R0076:Serac1	UTSW	17	6064937	splice site	probably benign
R0076:Serac1	UTSW	17	6064937	splice site	probably benign
R0127:Serac1	UTSW	17	6048840	missense	probably damaging	1.00
R0211:Serac1	UTSW	17	6050060	missense	possibly damaging	0.67
R0245:Serac1	UTSW	17	6051756	missense	probably damaging	1.00
R0538:Serac1	UTSW	17	6048826	splice site	probably benign
R0652:Serac1	UTSW	17	6051756	missense	probably damaging	1.00
R0988:Serac1	UTSW	17	6061580	missense	probably benign	0.02
R1965:Serac1	UTSW	17	6048999	missense	possibly damaging	0.72
R1984:Serac1	UTSW	17	6045689	splice site	probably null
R2145:Serac1	UTSW	17	6050785	missense	probably damaging	1.00
R3426:Serac1	UTSW	17	6066778	missense	probably benign	0.04
R3921:Serac1	UTSW	17	6066792	missense	probably damaging	1.00
R4760:Serac1	UTSW	17	6051790	missense	possibly damaging	0.69
R4958:Serac1	UTSW	17	6069382	missense	probably benign	0.15
R5552:Serac1	UTSW	17	6056692	nonsense	probably null
R5874:Serac1	UTSW	17	6043913	unclassified	probably benign
R5964:Serac1	UTSW	17	6065049	missense	probably benign
R6614:Serac1	UTSW	17	6045662	missense	probably damaging	1.00
R6794:Serac1	UTSW	17	6051710	missense	probably damaging	1.00
R6949:Serac1	UTSW	17	6051815	missense	probably damaging	1.00
R7157:Serac1	UTSW	17	6074201	missense	probably benign
R7161:Serac1	UTSW	17	6065076	missense	probably damaging	0.97
R7426:Serac1	UTSW	17	6069314	missense	probably damaging	1.00
R8270:Serac1	UTSW	17	6050758	missense	probably damaging	1.00
R8785:Serac1	UTSW	17	6044202	missense	probably damaging	0.99
R9057:Serac1	UTSW	17	6061615	missense	probably damaging	0.98
R9657:Serac1	UTSW	17	6069383	missense	probably benign	0.04
Z1088:Serac1	UTSW	17	6048918	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCACCCAGACTGTTATTAGC -3'
(R):5'- GTGAATGCTCTTAAGTTAGGCAGC -3'

Sequencing Primer
(F):5'- TTAGCTATCCCCTTCTAAGAAAACG -3'
(R):5'- CTCTTAAGTTAGGCAGCAAGGTTTG -3'

Posted On

2021-03-08