Incidental Mutation 'R8733:Serac1'
ID 662887
Institutional Source Beutler Lab
Gene Symbol Serac1
Ensembl Gene ENSMUSG00000015659
Gene Name serine active site containing 1
Synonyms 4930511N22Rik, D17Ertd141e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8733 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 6042196-6079741 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6050028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 479 (L479P)
Ref Sequence ENSEMBL: ENSMUSP00000095043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000097432]
AlphaFold Q3U213
Predicted Effect probably damaging
Transcript: ENSMUST00000024570
AA Change: L449P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659
AA Change: L449P

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
SCOP:d1jdha_ 243 336 3e-5 SMART
Pfam:PGAP1 360 519 3.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097432
AA Change: L479P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659
AA Change: L479P

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
SCOP:d1gw5a_ 89 464 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,358,801 L1106P probably damaging Het
Alx3 C G 3: 107,604,819 P258A probably damaging Het
Bbs9 A G 9: 22,670,832 T607A probably benign Het
Catsperg1 A T 7: 29,191,686 V644E possibly damaging Het
Cep85 T C 4: 134,148,161 K499E possibly damaging Het
Chd5 A T 4: 152,379,466 H1464L probably damaging Het
Chrne A G 11: 70,617,030 L281P probably damaging Het
Col3a1 A G 1: 45,340,312 probably benign Het
Cpsf4l A G 11: 113,709,453 F13L possibly damaging Het
Dgcr8 T C 16: 18,259,961 I603V probably benign Het
Dhx16 A G 17: 35,881,375 D102G probably benign Het
Dnm1 G T 2: 32,316,975 D564E probably benign Het
Dync1li1 T A 9: 114,705,110 Y93N probably damaging Het
Esp31 A G 17: 38,644,618 I51V probably benign Het
Grap G T 11: 61,671,691 A163S possibly damaging Het
Hgs G A 11: 120,470,128 probably null Het
Icosl A T 10: 78,073,863 N214I probably damaging Het
Ints6 G A 14: 62,696,848 P737S probably benign Het
Lima1 A G 15: 99,780,818 S581P probably damaging Het
Lrfn2 G A 17: 49,096,796 R649H probably damaging Het
Mrvi1 C T 7: 110,878,218 V564M probably benign Het
Muc5b A G 7: 141,863,795 T3493A possibly damaging Het
Mup4 A T 4: 59,958,587 N104K probably damaging Het
Nedd4 T C 9: 72,726,484 V424A possibly damaging Het
Olfr1117-ps1 A T 2: 87,284,772 I161F probably benign Het
Olfr794 T A 10: 129,570,710 D18E possibly damaging Het
Olfr930 A G 9: 38,930,689 I173V probably benign Het
Otop1 G A 5: 38,299,773 R292H probably damaging Het
Otop1 T A 5: 38,300,453 C518* probably null Het
Parp3 C T 9: 106,475,951 V9M probably benign Het
Pcdhb20 C T 18: 37,505,384 A321V probably damaging Het
Pik3c2g C T 6: 139,768,700 Q311* probably null Het
Pkd1l1 A T 11: 8,933,657 V855D Het
Polr2k T A 15: 36,176,767 D97E probably benign Het
Psmd11 A G 11: 80,434,516 probably benign Het
Ralgapa2 G A 2: 146,424,763 T631M probably damaging Het
Ralgps1 C A 2: 33,284,824 probably null Het
Rbm18 A G 2: 36,134,199 S17P probably damaging Het
Rcc1 C A 4: 132,338,204 L49F probably benign Het
Rgma T C 7: 73,409,288 S63P possibly damaging Het
Scn1a T A 2: 66,324,600 I672L probably benign Het
Sema4c T C 1: 36,552,873 T270A probably damaging Het
Slc22a16 A G 10: 40,574,065 M187V probably benign Het
Slc41a3 A T 6: 90,633,728 T191S possibly damaging Het
Slu7 G A 11: 43,443,340 V398M probably damaging Het
Sphk1 A G 11: 116,535,625 T136A probably benign Het
Sqstm1 G T 11: 50,210,666 P31Q possibly damaging Het
Trappc11 A T 8: 47,501,848 V885D probably damaging Het
Trav6-1 T A 14: 52,638,756 Y44* probably null Het
Trav9-2 T A 14: 53,591,298 C42S probably damaging Het
Zc2hc1a A G 3: 7,528,108 T194A probably benign Het
Zfp729a A G 13: 67,620,985 V375A probably damaging Het
Other mutations in Serac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Serac1 APN 17 6074253 splice site probably benign
IGL02642:Serac1 APN 17 6045746 missense possibly damaging 0.56
IGL02972:Serac1 APN 17 6070764 nonsense probably null
FR4304:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4340:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4342:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4589:Serac1 UTSW 17 6070808 missense probably damaging 1.00
PIT4480001:Serac1 UTSW 17 6050812 missense probably damaging 1.00
R0076:Serac1 UTSW 17 6064937 splice site probably benign
R0076:Serac1 UTSW 17 6064937 splice site probably benign
R0127:Serac1 UTSW 17 6048840 missense probably damaging 1.00
R0211:Serac1 UTSW 17 6050060 missense possibly damaging 0.67
R0245:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0538:Serac1 UTSW 17 6048826 splice site probably benign
R0652:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0988:Serac1 UTSW 17 6061580 missense probably benign 0.02
R1965:Serac1 UTSW 17 6048999 missense possibly damaging 0.72
R1984:Serac1 UTSW 17 6045689 splice site probably null
R2145:Serac1 UTSW 17 6050785 missense probably damaging 1.00
R3426:Serac1 UTSW 17 6066778 missense probably benign 0.04
R3921:Serac1 UTSW 17 6066792 missense probably damaging 1.00
R4760:Serac1 UTSW 17 6051790 missense possibly damaging 0.69
R4958:Serac1 UTSW 17 6069382 missense probably benign 0.15
R5552:Serac1 UTSW 17 6056692 nonsense probably null
R5874:Serac1 UTSW 17 6043913 unclassified probably benign
R5964:Serac1 UTSW 17 6065049 missense probably benign
R6614:Serac1 UTSW 17 6045662 missense probably damaging 1.00
R6794:Serac1 UTSW 17 6051710 missense probably damaging 1.00
R6949:Serac1 UTSW 17 6051815 missense probably damaging 1.00
R7157:Serac1 UTSW 17 6074201 missense probably benign
R7161:Serac1 UTSW 17 6065076 missense probably damaging 0.97
R7426:Serac1 UTSW 17 6069314 missense probably damaging 1.00
R8270:Serac1 UTSW 17 6050758 missense probably damaging 1.00
R8785:Serac1 UTSW 17 6044202 missense probably damaging 0.99
R9057:Serac1 UTSW 17 6061615 missense probably damaging 0.98
R9657:Serac1 UTSW 17 6069383 missense probably benign 0.04
Z1088:Serac1 UTSW 17 6048918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCACCCAGACTGTTATTAGC -3'
(R):5'- GTGAATGCTCTTAAGTTAGGCAGC -3'

Sequencing Primer
(F):5'- TTAGCTATCCCCTTCTAAGAAAACG -3'
(R):5'- CTCTTAAGTTAGGCAGCAAGGTTTG -3'
Posted On 2021-03-08