Incidental Mutation 'R8836:Ubxn2b'
ID 674136
Institutional Source Beutler Lab
Gene Symbol Ubxn2b
Ensembl Gene ENSMUSG00000028243
Gene Name UBX domain protein 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R8836 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 6191098-6221688 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 6216061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 328 (Q328L)
Ref Sequence ENSEMBL: ENSMUSP00000029907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029907]
AlphaFold Q0KL01
Predicted Effect probably damaging
Transcript: ENSMUST00000029907
AA Change: Q328L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029907
Gene: ENSMUSG00000028243
AA Change: Q328L

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
SEP 138 232 3.5e-39 SMART
UBX 251 330 1.05e-8 SMART
Meta Mutation Damage Score 0.7606 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T A 13: 34,932,543 W92R probably damaging Het
Ap4m1 T A 5: 138,174,799 I134N probably damaging Het
B020004J07Rik T C 4: 101,835,825 K326R probably benign Het
Cacna1b A G 2: 24,652,970 V1294A possibly damaging Het
Carmil1 A T 13: 24,155,046 S160T probably damaging Het
Ccdc7b C A 8: 129,131,031 probably benign Het
Chd9 T G 8: 91,041,184 N2436K probably damaging Het
Colca2 A G 9: 51,270,804 L156P probably damaging Het
Cradd G A 10: 95,322,600 A95V probably benign Het
Cttnbp2 T G 6: 18,375,953 E1529A probably damaging Het
Cyp11b1 T C 15: 74,838,538 I305V possibly damaging Het
Cyp2j6 A T 4: 96,523,746 N428K probably damaging Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Dysf C T 6: 84,116,123 R1073C probably damaging Het
Ei24 A G 9: 36,790,202 F23S Het
Enam T C 5: 88,491,265 probably null Het
Ezh2 A T 6: 47,554,262 C163S probably benign Het
Fam76b T A 9: 13,844,085 F329L probably benign Het
Gatad2b G A 3: 90,356,200 A535T probably damaging Het
Gm5622 T A 14: 51,559,313 probably benign Het
Gm9195 C A 14: 72,458,390 A1401S probably benign Het
Greb1l A T 18: 10,509,257 H523L probably benign Het
Grhl3 T A 4: 135,561,329 N15I probably damaging Het
Gsta3 A T 1: 21,260,059 Y95F probably benign Het
Htr1f C A 16: 64,926,833 G32V probably benign Het
Il18r1 C A 1: 40,495,856 Q404K probably benign Het
Izumo3 A T 4: 92,144,979 probably null Het
Kctd19 T A 8: 105,385,396 I806F probably damaging Het
Lama4 G T 10: 39,026,591 C187F probably damaging Het
Lamp3 T G 16: 19,701,038 I132L probably benign Het
Ly9 A T 1: 171,604,991 Y151* probably null Het
Lztr1 T C 16: 17,525,538 L474P probably benign Het
Mcm9 A T 10: 53,626,034 Y79N Het
Mocs2 T A 13: 114,825,224 N80K possibly damaging Het
Mrgbp T A 2: 180,582,919 C38S probably benign Het
Ncs1 G T 2: 31,246,147 probably benign Het
Olfr1048 T C 2: 86,236,544 N90S probably benign Het
Olfr642 G A 7: 104,049,848 P169S probably benign Het
Palm2 A G 4: 57,709,916 D287G probably benign Het
Pax5 A T 4: 44,645,621 V236E probably benign Het
Pcdhgb5 A G 18: 37,732,207 I352V probably benign Het
Pik3r5 A G 11: 68,494,278 T670A probably benign Het
Plxna2 T A 1: 194,796,935 N1301K possibly damaging Het
Pou5f2 G A 13: 78,025,767 G276D probably damaging Het
Ppl C G 16: 5,088,990 R1147P probably damaging Het
Prkdc C A 16: 15,727,659 R1880S probably damaging Het
Rbfox1 T A 16: 7,409,741 D373E probably benign Het
Rbm24 A G 13: 46,429,304 D233G probably damaging Het
Rbp3 A T 14: 33,958,631 E1063D possibly damaging Het
Rc3h2 A G 2: 37,377,929 V939A possibly damaging Het
Relb C A 7: 19,611,874 V385L possibly damaging Het
Robo4 T G 9: 37,405,834 S482A unknown Het
Ryr1 A C 7: 29,074,666 L2426R probably damaging Het
Sass6 A T 3: 116,613,949 E238V possibly damaging Het
Ski T C 4: 155,160,590 I400V probably benign Het
Slc27a2 C A 2: 126,574,736 A336D Het
Slc30a3 T C 5: 31,093,324 T12A possibly damaging Het
Slc6a6 T C 6: 91,748,463 V447A probably damaging Het
Smad1 T A 8: 79,371,925 I87F probably damaging Het
Spns1 G A 7: 126,372,421 S319F possibly damaging Het
Sytl3 C A 17: 6,706,011 T237N possibly damaging Het
Tdrd7 A G 4: 45,987,570 T68A probably damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem238 A G 7: 4,789,521 C8R possibly damaging Het
Vmn1r226 A G 17: 20,687,871 T122A probably benign Het
Vps13d A G 4: 145,156,078 F982L Het
Xpo4 T C 14: 57,664,910 E16G probably benign Het
Zbtb17 T A 4: 141,461,922 M51K possibly damaging Het
Zdhhc1 A G 8: 105,473,541 F315S probably benign Het
Zfp568 C T 7: 30,023,034 T468M probably damaging Het
Other mutations in Ubxn2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Ubxn2b APN 4 6203767 splice site probably null
IGL02096:Ubxn2b APN 4 6214749 missense probably damaging 1.00
IGL02272:Ubxn2b APN 4 6216071 missense probably damaging 1.00
R0081:Ubxn2b UTSW 4 6203875 splice site probably benign
R0482:Ubxn2b UTSW 4 6196404 splice site probably null
R1903:Ubxn2b UTSW 4 6208889 missense possibly damaging 0.82
R4206:Ubxn2b UTSW 4 6204565 missense probably damaging 0.99
R5071:Ubxn2b UTSW 4 6214746 missense probably damaging 1.00
R7622:Ubxn2b UTSW 4 6214692 missense probably damaging 0.98
R8034:Ubxn2b UTSW 4 6191167 missense probably benign 0.06
R9156:Ubxn2b UTSW 4 6214646 missense probably damaging 1.00
R9413:Ubxn2b UTSW 4 6204607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCCCTTTTCTACAATAAGCC -3'
(R):5'- TTTATAAGCTATCAATACAAGCCAGCC -3'

Sequencing Primer
(F):5'- ACAATAAGCCATTTTCCTTCTTCC -3'
(R):5'- GCCAGCCCTACAACTAAGAATTC -3'
Posted On 2021-07-15