Incidental Mutation 'R9013:Meis1'
ID685776
Institutional Source Beutler Lab
Gene Symbol Meis1
Ensembl Gene ENSMUSG00000020160
Gene NameMeis homeobox 1
SynonymsC530044H18Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R9013 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location18879817-19018985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19016354 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 6 (D6E)
Ref Sequence ENSEMBL: ENSMUSP00000139219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068264] [ENSMUST00000102878] [ENSMUST00000144988] [ENSMUST00000177417] [ENSMUST00000185131]
Predicted Effect
SMART Domains Protein: ENSMUSP00000069277
Gene: ENSMUSG00000020160
AA Change: D6E

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102878
AA Change: D6E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099942
Gene: ENSMUSG00000020160
AA Change: D6E

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
Pfam:Meis_PKNOX_N 108 192 5.5e-48 PFAM
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000144988
AA Change: D6E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134969
Gene: ENSMUSG00000020160
AA Change: D6E

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 358 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177357
Predicted Effect probably benign
Transcript: ENSMUST00000177417
AA Change: D6E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135726
Gene: ENSMUSG00000020160
AA Change: D6E

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185131
AA Change: D6E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139219
Gene: ENSMUSG00000020160
AA Change: D6E

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice die during gestation and exhibit eye, vasculature, and hematopoietic defects. Mice homozygous for a conditional allele activated in HSCs exhibit altered bone marrow cell development, altered HSC physiology and increased reactive oxygen species production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik G T 14: 70,156,727 L200I probably damaging Het
Afap1 G A 5: 35,976,588 D456N possibly damaging Het
Afm A T 5: 90,523,735 D92V probably damaging Het
Ahi1 T C 10: 21,007,759 I841T probably benign Het
Asb1 T C 1: 91,552,441 probably null Het
Astn1 A T 1: 158,520,500 I507F probably damaging Het
Astn2 A G 4: 65,992,347 M468T probably benign Het
C030006K11Rik T C 15: 76,723,804 S5G probably benign Het
C9 A T 15: 6,486,712 D332V probably damaging Het
Cacna1c A T 6: 118,742,305 S423T probably damaging Het
Cbx8 T C 11: 119,038,823 I315V possibly damaging Het
Ccdc50 T A 16: 27,409,356 I91N probably damaging Het
Col4a1 T A 8: 11,222,270 I707L probably benign Het
Cyc1 T C 15: 76,344,819 V154A possibly damaging Het
Cyp4f40 A T 17: 32,671,199 H281L probably benign Het
D130052B06Rik T G 11: 33,623,491 C74W unknown Het
Dap G A 15: 31,273,198 G66D probably damaging Het
Dclk3 A T 9: 111,468,498 H370L probably benign Het
Dgka C A 10: 128,730,202 E360* probably null Het
Dst A G 1: 34,178,084 I1202V possibly damaging Het
Fzd10 C G 5: 128,602,305 P363R probably damaging Het
Gm340 T A 19: 41,584,750 V648D probably damaging Het
Gm4869 A T 5: 140,463,613 Y180F probably damaging Het
Gm906 T C 13: 50,247,552 H246R possibly damaging Het
Gpx2 A G 12: 76,795,344 L11P probably damaging Het
Greb1 A G 12: 16,739,969 L26S probably damaging Het
Gtpbp2 A G 17: 46,164,814 K163R probably benign Het
Hsd3b1 A T 3: 98,852,661 L338Q probably damaging Het
Il15ra A G 2: 11,727,765 S67G probably benign Het
Kcnc2 C T 10: 112,271,818 A38V probably damaging Het
Klk1b16 A G 7: 44,140,908 D169G probably benign Het
Kmt2a T C 9: 44,849,911 K214E probably damaging Het
Lrriq1 C T 10: 103,215,070 G607D probably damaging Het
Lysmd3 T A 13: 81,669,461 S186T probably damaging Het
Mfsd4b2 T G 10: 39,922,066 T98P probably benign Het
Muc16 T A 9: 18,512,773 E8193V possibly damaging Het
Nr1i3 A G 1: 171,214,457 T37A probably damaging Het
Nr5a2 A T 1: 136,945,007 D112E probably damaging Het
Oas1c A G 5: 120,805,432 I214T probably damaging Het
Olfr109 G A 17: 37,466,550 V115M probably benign Het
Olfr271-ps1 C A 4: 52,935,900 A128S probably benign Het
Olfr482 A G 7: 108,095,264 I102T probably benign Het
Olfr533 A T 7: 140,466,266 R22W probably benign Het
Olfr800 T C 10: 129,659,833 F9S probably damaging Het
Olfr834 A T 9: 18,988,578 I197F possibly damaging Het
Omp A G 7: 98,145,345 M25T probably benign Het
Paf1 A G 7: 28,398,708 E381G unknown Het
Pcdhga8 A G 18: 37,725,944 T18A probably benign Het
Pclo T C 5: 14,677,613 S2162P unknown Het
Psg25 T C 7: 18,524,765 I329V probably benign Het
Ptov1 A G 7: 44,865,561 S209P possibly damaging Het
Ralgapb A G 2: 158,437,140 K397E probably damaging Het
Ryr2 T A 13: 11,603,732 T3866S probably damaging Het
Sdccag8 G A 1: 176,824,805 V41I probably benign Het
Sdf2l1 T A 16: 17,130,766 D136V possibly damaging Het
Slc26a7 A T 4: 14,506,514 S612T probably damaging Het
Snf8 T C 11: 96,039,300 F43L probably benign Het
Snta1 A T 2: 154,403,889 M104K probably damaging Het
Sox2 T A 3: 34,650,597 M61K probably damaging Het
Spats2 T A 15: 99,199,247 D293E probably damaging Het
Spta1 A G 1: 174,222,608 D1738G probably damaging Het
Sqstm1 A T 11: 50,207,857 Y89N probably damaging Het
Stat4 T A 1: 52,011,798 N5K probably benign Het
Syne4 A G 7: 30,317,993 H294R probably damaging Het
Tbc1d7 A C 13: 43,168,834 F45V probably damaging Het
Tekt3 T A 11: 63,083,858 N334K probably damaging Het
Tgfbr3l A G 8: 4,250,620 H266R possibly damaging Het
Trav7-6 A G 14: 53,717,147 K65E probably benign Het
Trip11 A G 12: 101,885,118 S896P probably damaging Het
Tubb6 T C 18: 67,392,976 V66A possibly damaging Het
Tyk2 A G 9: 21,105,107 L1189P probably damaging Het
Usp34 T G 11: 23,370,302 V911G Het
Wdr53 C T 16: 32,256,595 A206V probably damaging Het
Xrn1 A G 9: 96,038,928 E1364G probably benign Het
Ywhag T C 5: 135,911,363 M126V probably damaging Het
Zfp383 C T 7: 29,915,292 P324L probably damaging Het
Other mutations in Meis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Meis1 APN 11 18881811 missense probably benign 0.25
IGL02156:Meis1 APN 11 19011292 missense probably benign 0.03
IGL02376:Meis1 APN 11 18881752 missense probably benign 0.06
R0505:Meis1 UTSW 11 19011360 missense probably damaging 0.99
R0833:Meis1 UTSW 11 18881767 missense possibly damaging 0.91
R1477:Meis1 UTSW 11 18881665 nonsense probably null
R1512:Meis1 UTSW 11 18881682 missense probably damaging 0.97
R1643:Meis1 UTSW 11 19016278 missense probably benign 0.00
R1717:Meis1 UTSW 11 19010608 intron probably benign
R2117:Meis1 UTSW 11 18881679 missense probably damaging 1.00
R2342:Meis1 UTSW 11 18881647 missense probably damaging 1.00
R2426:Meis1 UTSW 11 18988356 missense possibly damaging 0.64
R3076:Meis1 UTSW 11 19011254 missense probably benign 0.01
R3078:Meis1 UTSW 11 19011254 missense probably benign 0.01
R4368:Meis1 UTSW 11 19010656 intron probably benign
R4915:Meis1 UTSW 11 19009222 intron probably benign
R4916:Meis1 UTSW 11 18881776 missense possibly damaging 0.91
R4917:Meis1 UTSW 11 19009222 intron probably benign
R4918:Meis1 UTSW 11 19009222 intron probably benign
R4948:Meis1 UTSW 11 19016308 missense probably benign 0.00
R5093:Meis1 UTSW 11 18881785 missense probably benign 0.13
R5506:Meis1 UTSW 11 18941747 missense possibly damaging 0.52
R5507:Meis1 UTSW 11 19016168 missense probably benign 0.27
R5521:Meis1 UTSW 11 18988260 splice site probably benign
R5673:Meis1 UTSW 11 19012812 missense probably damaging 1.00
R5813:Meis1 UTSW 11 19016229 missense probably benign 0.11
R6347:Meis1 UTSW 11 18905631 splice site probably null
R6354:Meis1 UTSW 11 19016184 missense possibly damaging 0.89
R6383:Meis1 UTSW 11 18941741 missense probably benign
R6624:Meis1 UTSW 11 19016215 missense probably benign
R7292:Meis1 UTSW 11 19011351 missense probably damaging 1.00
R7413:Meis1 UTSW 11 18988357 missense probably damaging 1.00
R7434:Meis1 UTSW 11 18885542 missense unknown
R7571:Meis1 UTSW 11 18941702 missense probably damaging 1.00
R8719:Meis1 UTSW 11 18885587 missense probably benign
R9043:Meis1 UTSW 11 18881916 missense possibly damaging 0.58
Z1176:Meis1 UTSW 11 19014317 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAAGCGTCATTGACCGAGG -3'
(R):5'- CTCAGATGACTCTCACTGAGAATTC -3'

Sequencing Primer
(F):5'- GTCATTGACCGAGGAACCCATG -3'
(R):5'- GACTCTCACTGAGAATTCTGGAGC -3'
Posted On2021-10-11