Incidental Mutation 'R1477:Meis1'
ID164140
Institutional Source Beutler Lab
Gene Symbol Meis1
Ensembl Gene ENSMUSG00000020160
Gene NameMeis homeobox 1
SynonymsC530044H18Rik
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1477 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location18879817-19018985 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 18881665 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 458 (Q458*)
Ref Sequence ENSEMBL: ENSMUSP00000139219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068264] [ENSMUST00000102878] [ENSMUST00000144988] [ENSMUST00000177417] [ENSMUST00000185131]
Predicted Effect probably benign
Transcript: ENSMUST00000068264
SMART Domains Protein: ENSMUSP00000069277
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102878
SMART Domains Protein: ENSMUSP00000099942
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
Pfam:Meis_PKNOX_N 108 192 5.5e-48 PFAM
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118661
SMART Domains Protein: ENSMUSP00000112809
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
HOX 92 157 5.3e-14 SMART
low complexity region 192 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144988
SMART Domains Protein: ENSMUSP00000134969
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 358 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177357
Predicted Effect probably benign
Transcript: ENSMUST00000177417
SMART Domains Protein: ENSMUSP00000135726
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185131
AA Change: Q458*
SMART Domains Protein: ENSMUSP00000139219
Gene: ENSMUSG00000020160
AA Change: Q458*

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194952
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice die during gestation and exhibit eye, vasculature, and hematopoietic defects. Mice homozygous for a conditional allele activated in HSCs exhibit altered bone marrow cell development, altered HSC physiology and increased reactive oxygen species production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Meis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Meis1 APN 11 18881811 missense probably benign 0.25
IGL02156:Meis1 APN 11 19011292 missense probably benign 0.03
IGL02376:Meis1 APN 11 18881752 missense probably benign 0.06
R0505:Meis1 UTSW 11 19011360 missense probably damaging 0.99
R0833:Meis1 UTSW 11 18881767 missense possibly damaging 0.91
R1512:Meis1 UTSW 11 18881682 missense probably damaging 0.97
R1643:Meis1 UTSW 11 19016278 missense probably benign 0.00
R1717:Meis1 UTSW 11 19010608 intron probably benign
R2117:Meis1 UTSW 11 18881679 missense probably damaging 1.00
R2342:Meis1 UTSW 11 18881647 missense probably damaging 1.00
R2426:Meis1 UTSW 11 18988356 missense possibly damaging 0.64
R3076:Meis1 UTSW 11 19011254 missense probably benign 0.01
R3078:Meis1 UTSW 11 19011254 missense probably benign 0.01
R4368:Meis1 UTSW 11 19010656 intron probably benign
R4915:Meis1 UTSW 11 19009222 intron probably benign
R4916:Meis1 UTSW 11 18881776 missense possibly damaging 0.91
R4917:Meis1 UTSW 11 19009222 intron probably benign
R4918:Meis1 UTSW 11 19009222 intron probably benign
R4948:Meis1 UTSW 11 19016308 missense probably benign 0.00
R5093:Meis1 UTSW 11 18881785 missense probably benign 0.13
R5506:Meis1 UTSW 11 18941747 missense possibly damaging 0.52
R5507:Meis1 UTSW 11 19016168 missense probably benign 0.27
R5521:Meis1 UTSW 11 18988260 splice site probably benign
R5673:Meis1 UTSW 11 19012812 missense probably damaging 1.00
R5813:Meis1 UTSW 11 19016229 missense probably benign 0.11
R6347:Meis1 UTSW 11 18905631 splice site probably null
R6354:Meis1 UTSW 11 19016184 missense possibly damaging 0.89
R6383:Meis1 UTSW 11 18941741 missense probably benign
R6624:Meis1 UTSW 11 19016215 missense probably benign
R7292:Meis1 UTSW 11 19011351 missense probably damaging 1.00
R7413:Meis1 UTSW 11 18988357 missense probably damaging 1.00
R7434:Meis1 UTSW 11 18885542 missense unknown
R7571:Meis1 UTSW 11 18941702 missense probably damaging 1.00
R8719:Meis1 UTSW 11 18885587 missense probably benign
Z1176:Meis1 UTSW 11 19014317 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAATCAGACCTTCCTGTCCCTTG -3'
(R):5'- CCATAGTCAGAACCACACTGTTGCC -3'

Sequencing Primer
(F):5'- TGCATGTCCCCCGAGTTG -3'
(R):5'- ttctttcttttGAATTTCTACAGGGC -3'
Posted On2014-03-28