Incidental Mutation 'R2342:Meis1'
ID246791
Institutional Source Beutler Lab
Gene Symbol Meis1
Ensembl Gene ENSMUSG00000020160
Gene NameMeis homeobox 1
SynonymsC530044H18Rik
MMRRC Submission 040328-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2342 (G1)
Quality Score191
Status Validated
Chromosome11
Chromosomal Location18879817-19018985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18881647 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 464 (A464T)
Ref Sequence ENSEMBL: ENSMUSP00000139219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068264] [ENSMUST00000102878] [ENSMUST00000144988] [ENSMUST00000177417] [ENSMUST00000185131]
Predicted Effect probably benign
Transcript: ENSMUST00000068264
SMART Domains Protein: ENSMUSP00000069277
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102878
SMART Domains Protein: ENSMUSP00000099942
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
Pfam:Meis_PKNOX_N 108 192 5.5e-48 PFAM
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118661
SMART Domains Protein: ENSMUSP00000112809
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
HOX 92 157 5.3e-14 SMART
low complexity region 192 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144988
SMART Domains Protein: ENSMUSP00000134969
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
low complexity region 358 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177357
Predicted Effect probably benign
Transcript: ENSMUST00000177417
SMART Domains Protein: ENSMUSP00000135726
Gene: ENSMUSG00000020160

DomainStartEndE-ValueType
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185131
AA Change: A464T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139219
Gene: ENSMUSG00000020160
AA Change: A464T

DomainStartEndE-ValueType
internal_repeat_1 12 59 8.66e-5 PROSPERO
low complexity region 225 241 N/A INTRINSIC
HOX 272 337 1.05e-11 SMART
internal_repeat_1 384 428 8.66e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194952
Meta Mutation Damage Score 0.1288 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die during gestation and exhibit eye, vasculature, and hematopoietic defects. Mice homozygous for a conditional allele activated in HSCs exhibit altered bone marrow cell development, altered HSC physiology and increased reactive oxygen species production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 C T 13: 97,994,029 E434K probably benign Het
Babam1 T A 8: 71,402,871 M236K probably benign Het
Camk1 T C 6: 113,341,981 probably benign Het
Chd8 A C 14: 52,205,217 N625K probably benign Het
Dcaf8 A G 1: 172,186,361 H373R possibly damaging Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
Elf1 T C 14: 79,565,456 probably benign Het
Epha2 C T 4: 141,323,531 A866V probably benign Het
Frmd6 C A 12: 70,883,818 Y237* probably null Het
Glg1 A T 8: 111,187,807 C448* probably null Het
Gm4787 G T 12: 81,378,758 R209S possibly damaging Het
Hhipl1 T C 12: 108,318,462 L358P probably damaging Het
Hmgxb3 G A 18: 61,162,991 T315I possibly damaging Het
Irak2 C A 6: 113,693,671 T539K probably benign Het
Lrp1b C A 2: 40,919,196 G2568C possibly damaging Het
Olfr1511 C A 14: 52,389,865 A303S possibly damaging Het
Olfr2 T C 7: 107,000,909 D317G probably benign Het
Orc4 A G 2: 48,927,140 S179P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pnliprp1 A G 19: 58,741,259 probably benign Het
Prpf40b T A 15: 99,306,168 V174D probably damaging Het
Rnf169 T C 7: 99,925,445 K648E possibly damaging Het
Rtf1 A G 2: 119,712,117 T301A probably benign Het
Sdccag8 T C 1: 176,919,641 V528A probably benign Het
Sgsh A G 11: 119,347,714 V308A probably benign Het
Shmt2 A G 10: 127,518,811 V335A possibly damaging Het
Skint6 T A 4: 113,176,983 T316S probably benign Het
Tbl2 G A 5: 135,158,753 R288Q possibly damaging Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Usp34 A G 11: 23,403,599 K1469E possibly damaging Het
Virma T C 4: 11,501,316 Y92H probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt16 A G 6: 22,288,924 E80G probably damaging Het
Zbtb10 C T 3: 9,265,195 P538S possibly damaging Het
Zufsp G A 10: 33,928,117 H454Y probably damaging Het
Other mutations in Meis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Meis1 APN 11 18881811 missense probably benign 0.25
IGL02156:Meis1 APN 11 19011292 missense probably benign 0.03
IGL02376:Meis1 APN 11 18881752 missense probably benign 0.06
R0505:Meis1 UTSW 11 19011360 missense probably damaging 0.99
R0833:Meis1 UTSW 11 18881767 missense possibly damaging 0.91
R1477:Meis1 UTSW 11 18881665 nonsense probably null
R1512:Meis1 UTSW 11 18881682 missense probably damaging 0.97
R1643:Meis1 UTSW 11 19016278 missense probably benign 0.00
R1717:Meis1 UTSW 11 19010608 intron probably benign
R2117:Meis1 UTSW 11 18881679 missense probably damaging 1.00
R2426:Meis1 UTSW 11 18988356 missense possibly damaging 0.64
R3076:Meis1 UTSW 11 19011254 missense probably benign 0.01
R3078:Meis1 UTSW 11 19011254 missense probably benign 0.01
R4368:Meis1 UTSW 11 19010656 intron probably benign
R4915:Meis1 UTSW 11 19009222 intron probably benign
R4916:Meis1 UTSW 11 18881776 missense possibly damaging 0.91
R4917:Meis1 UTSW 11 19009222 intron probably benign
R4918:Meis1 UTSW 11 19009222 intron probably benign
R4948:Meis1 UTSW 11 19016308 missense probably benign 0.00
R5093:Meis1 UTSW 11 18881785 missense probably benign 0.13
R5506:Meis1 UTSW 11 18941747 missense possibly damaging 0.52
R5507:Meis1 UTSW 11 19016168 missense probably benign 0.27
R5521:Meis1 UTSW 11 18988260 splice site probably benign
R5673:Meis1 UTSW 11 19012812 missense probably damaging 1.00
R5813:Meis1 UTSW 11 19016229 missense probably benign 0.11
R6347:Meis1 UTSW 11 18905631 intron probably null
R6354:Meis1 UTSW 11 19016184 missense possibly damaging 0.89
R6383:Meis1 UTSW 11 18941741 missense probably benign
R6624:Meis1 UTSW 11 19016215 missense probably benign
R7292:Meis1 UTSW 11 19011351 missense probably damaging 1.00
R7413:Meis1 UTSW 11 18988357 missense probably damaging 1.00
R7434:Meis1 UTSW 11 18885542 missense unknown
R7571:Meis1 UTSW 11 18941702 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGACTTCGGATGGTTCTCC -3'
(R):5'- CCAATGGGTGTGAGTATGGGAC -3'

Sequencing Primer
(F):5'- CCTGCATTTTAAGAGTCCCTATGAAG -3'
(R):5'- TGGGACAGCCGAGTTATACC -3'
Posted On2014-10-30