Incidental Mutation 'R9030:Cdc73'
ID 686974
Institutional Source Beutler Lab
Gene Symbol Cdc73
Ensembl Gene ENSMUSG00000026361
Gene Name cell division cycle 73, Paf1/RNA polymerase II complex component
Synonyms Hrpt2, 8430414L16Rik, C130030P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9030 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 143598800-143702893 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 143609496 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 478 (L478H)
Ref Sequence ENSEMBL: ENSMUSP00000018337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018337]
AlphaFold Q8JZM7
Predicted Effect probably damaging
Transcript: ENSMUST00000018337
AA Change: L478H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018337
Gene: ENSMUSG00000026361
AA Change: L478H

DomainStartEndE-ValueType
Pfam:CDC73_N 1 297 3.4e-135 PFAM
Pfam:CDC73_C 356 521 2.6e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone methyltransferase complex. This protein appears to facilitate the association of 3' mRNA processing factors with actively-transcribed chromatin. Mutations in this gene have been linked to hyperparathyroidism-jaw tumor syndrome, familial isolated hyperparathyroidism, and parathyroid carcinoma. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality around hatching or implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,379,407 F514S probably damaging Het
Actr5 A C 2: 158,632,401 I375L probably benign Het
Adgrl2 G T 3: 148,839,125 T778K possibly damaging Het
Cdh7 C A 1: 110,100,113 H529Q probably benign Het
Cep55 T C 19: 38,071,144 probably null Het
Chd9 G A 8: 90,956,570 R546Q unknown Het
Ddit4 A T 10: 59,950,693 L178Q probably damaging Het
Dgke A T 11: 89,050,411 N315K possibly damaging Het
Dsg1a A G 18: 20,340,492 D874G probably damaging Het
Dsp T A 13: 38,168,697 Y184N probably damaging Het
Dynlt1c A G 17: 6,603,517 I20V probably benign Het
Ephx4 A G 5: 107,429,683 H291R possibly damaging Het
Epx A T 11: 87,872,644 M250K probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fer1l6 A T 15: 58,630,745 Y1365F probably damaging Het
Fndc8 A G 11: 82,898,696 T227A probably benign Het
Gbp7 T C 3: 142,538,037 I115T probably damaging Het
Gm5145 A G 17: 20,571,008 E216G probably benign Het
Gm94 A T 18: 43,781,261 F77L possibly damaging Het
Grik3 C A 4: 125,632,392 H139Q probably benign Het
Gucy2e T C 11: 69,225,001 T852A probably damaging Het
Hif1a T C 12: 73,936,236 S274P probably damaging Het
Hmcn1 T A 1: 150,817,119 I268L probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lin52 T A 12: 84,545,907 S87T Het
Lrrc74b A G 16: 17,549,776 probably null Het
Mapk10 T C 5: 102,996,633 K136R probably damaging Het
Nlrp2 A T 7: 5,322,458 N738K probably null Het
Nlrp5 A T 7: 23,430,148 Q880L possibly damaging Het
Nov A T 15: 54,752,291 Y284F probably damaging Het
Olfr1167 A T 2: 88,149,374 I215N possibly damaging Het
Olfr1381 T A 11: 49,551,981 V78E probably damaging Het
Olfr811 G T 10: 129,802,057 P156Q probably damaging Het
P4htm G A 9: 108,597,428 P46L probably benign Het
Pcsk4 A T 10: 80,329,024 H69Q probably damaging Het
Pdzd2 A G 15: 12,374,299 S1917P probably benign Het
Pnpla5 A G 15: 84,113,886 V385A possibly damaging Het
Rims2 C T 15: 39,476,477 R856C probably damaging Het
Rprd2 A G 3: 95,784,310 Y218H probably benign Het
Sat2 T A 11: 69,622,243 probably benign Het
Sf1 C T 19: 6,376,306 R186C Het
Snrnp200 A G 2: 127,211,546 probably benign Het
Sqor A T 2: 122,787,594 D124V probably benign Het
Ssh2 A G 11: 77,421,236 H191R possibly damaging Het
Stac C A 9: 111,690,252 probably benign Het
Svs4 T C 2: 164,277,138 M93V unknown Het
Tbc1d32 A T 10: 56,161,145 S668T possibly damaging Het
Tex10 A G 4: 48,452,056 F690S probably damaging Het
Tex30 A G 1: 44,091,196 M88T Het
Tgfbrap1 T C 1: 43,056,677 T534A probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnrc18 T C 5: 142,726,063 E2647G probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb3 A T 8: 123,418,957 R62W probably damaging Het
Vmn2r108 A G 17: 20,470,050 S507P probably benign Het
Vmn2r116 A G 17: 23,384,890 K30E possibly damaging Het
Vmn2r14 G A 5: 109,220,188 H313Y probably damaging Het
Wdr37 C T 13: 8,835,388 V340M probably damaging Het
Zfp799 A G 17: 32,820,591 F234L possibly damaging Het
Other mutations in Cdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Cdc73 APN 1 143671332 missense probably benign 0.10
IGL01598:Cdc73 APN 1 143699279 missense probably damaging 1.00
R0648:Cdc73 UTSW 1 143695462 missense probably benign 0.00
R1299:Cdc73 UTSW 1 143699281 missense probably benign 0.00
R1342:Cdc73 UTSW 1 143702492 critical splice donor site probably null
R1411:Cdc73 UTSW 1 143609514 splice site probably benign
R1837:Cdc73 UTSW 1 143667657 missense possibly damaging 0.46
R2208:Cdc73 UTSW 1 143609382 missense probably damaging 1.00
R3721:Cdc73 UTSW 1 143695453 missense possibly damaging 0.77
R3797:Cdc73 UTSW 1 143677723 missense probably benign 0.22
R4088:Cdc73 UTSW 1 143608514 utr 3 prime probably benign
R4603:Cdc73 UTSW 1 143677857 critical splice acceptor site probably null
R4782:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R4799:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R5512:Cdc73 UTSW 1 143702616 missense probably damaging 1.00
R5801:Cdc73 UTSW 1 143608543 missense probably benign 0.01
R6006:Cdc73 UTSW 1 143617439 missense probably damaging 1.00
R6258:Cdc73 UTSW 1 143691473 missense probably benign 0.32
R6260:Cdc73 UTSW 1 143691473 missense probably benign 0.32
R6744:Cdc73 UTSW 1 143702149 intron probably benign
R8513:Cdc73 UTSW 1 143617391 nonsense probably null
R9431:Cdc73 UTSW 1 143670002 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGACAATGTTCAAAGCAAGG -3'
(R):5'- ACCGTTTTGGCTGTTTCAGAGATC -3'

Sequencing Primer
(F):5'- GACAATGTTCAAAGCAAGGAATTAC -3'
(R):5'- GGCTGTTTCAGAGATCACTAATTAC -3'
Posted On 2021-11-19