Incidental Mutation 'R9030:Grik3'
ID 686985
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R9030 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 125490700-125714173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 125632392 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 139 (H139Q)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably benign
Transcript: ENSMUST00000030676
AA Change: H139Q

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: H139Q

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,379,407 F514S probably damaging Het
Actr5 A C 2: 158,632,401 I375L probably benign Het
Adgrl2 G T 3: 148,839,125 T778K possibly damaging Het
Cdc73 A T 1: 143,609,496 L478H probably damaging Het
Cdh7 C A 1: 110,100,113 H529Q probably benign Het
Cep55 T C 19: 38,071,144 probably null Het
Chd9 G A 8: 90,956,570 R546Q unknown Het
Ddit4 A T 10: 59,950,693 L178Q probably damaging Het
Dgke A T 11: 89,050,411 N315K possibly damaging Het
Dsg1a A G 18: 20,340,492 D874G probably damaging Het
Dsp T A 13: 38,168,697 Y184N probably damaging Het
Dynlt1c A G 17: 6,603,517 I20V probably benign Het
Ephx4 A G 5: 107,429,683 H291R possibly damaging Het
Epx A T 11: 87,872,644 M250K probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fer1l6 A T 15: 58,630,745 Y1365F probably damaging Het
Fndc8 A G 11: 82,898,696 T227A probably benign Het
Gbp7 T C 3: 142,538,037 I115T probably damaging Het
Gm5145 A G 17: 20,571,008 E216G probably benign Het
Gm94 A T 18: 43,781,261 F77L possibly damaging Het
Gucy2e T C 11: 69,225,001 T852A probably damaging Het
Hif1a T C 12: 73,936,236 S274P probably damaging Het
Hmcn1 T A 1: 150,817,119 I268L probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lin52 T A 12: 84,545,907 S87T Het
Lrrc74b A G 16: 17,549,776 probably null Het
Mapk10 T C 5: 102,996,633 K136R probably damaging Het
Nlrp2 A T 7: 5,322,458 N738K probably null Het
Nlrp5 A T 7: 23,430,148 Q880L possibly damaging Het
Nov A T 15: 54,752,291 Y284F probably damaging Het
Olfr1167 A T 2: 88,149,374 I215N possibly damaging Het
Olfr1381 T A 11: 49,551,981 V78E probably damaging Het
Olfr811 G T 10: 129,802,057 P156Q probably damaging Het
P4htm G A 9: 108,597,428 P46L probably benign Het
Pcsk4 A T 10: 80,329,024 H69Q probably damaging Het
Pdzd2 A G 15: 12,374,299 S1917P probably benign Het
Pnpla5 A G 15: 84,113,886 V385A possibly damaging Het
Rims2 C T 15: 39,476,477 R856C probably damaging Het
Rprd2 A G 3: 95,784,310 Y218H probably benign Het
Sf1 C T 19: 6,376,306 R186C Het
Sqor A T 2: 122,787,594 D124V probably benign Het
Ssh2 A G 11: 77,421,236 H191R possibly damaging Het
Stac C A 9: 111,690,252 probably benign Het
Svs4 T C 2: 164,277,138 M93V unknown Het
Tbc1d32 A T 10: 56,161,145 S668T possibly damaging Het
Tex10 A G 4: 48,452,056 F690S probably damaging Het
Tex30 A G 1: 44,091,196 M88T Het
Tgfbrap1 T C 1: 43,056,677 T534A probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnrc18 T C 5: 142,726,063 E2647G probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb3 A T 8: 123,418,957 R62W probably damaging Het
Vmn2r108 A G 17: 20,470,050 S507P probably benign Het
Vmn2r116 A G 17: 23,384,890 K30E possibly damaging Het
Vmn2r14 G A 5: 109,220,188 H313Y probably damaging Het
Wdr37 C T 13: 8,835,388 V340M probably damaging Het
Zfp799 A G 17: 32,820,591 F234L possibly damaging Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125632415 missense probably benign
IGL01534:Grik3 APN 4 125686190 missense probably damaging 1.00
IGL01538:Grik3 APN 4 125694036 missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125623502 missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125685990 splice site probably benign
IGL02475:Grik3 APN 4 125650517 missense probably benign
IGL03198:Grik3 APN 4 125659762 missense probably benign 0.25
IGL03307:Grik3 APN 4 125641554 missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0116:Grik3 UTSW 4 125670556 missense probably benign 0.01
R0208:Grik3 UTSW 4 125686165 missense probably damaging 1.00
R0497:Grik3 UTSW 4 125623510 missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125704564 splice site probably benign
R1296:Grik3 UTSW 4 125704564 splice site probably benign
R1515:Grik3 UTSW 4 125670728 missense probably benign 0.37
R1559:Grik3 UTSW 4 125707997 missense probably benign 0.16
R1617:Grik3 UTSW 4 125691192 missense probably benign
R1848:Grik3 UTSW 4 125694138 missense probably damaging 1.00
R2903:Grik3 UTSW 4 125670644 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3842:Grik3 UTSW 4 125693954 splice site probably benign
R4649:Grik3 UTSW 4 125650485 missense probably damaging 1.00
R4841:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R4842:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R5093:Grik3 UTSW 4 125670589 missense probably benign
R5318:Grik3 UTSW 4 125694136 missense probably damaging 0.96
R5549:Grik3 UTSW 4 125686045 missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125705123 missense probably damaging 0.99
R6226:Grik3 UTSW 4 125659789 missense probably benign 0.04
R6306:Grik3 UTSW 4 125632412 missense probably benign 0.01
R6672:Grik3 UTSW 4 125623516 missense probably benign 0.08
R6682:Grik3 UTSW 4 125650466 missense probably damaging 1.00
R6783:Grik3 UTSW 4 125632300 missense probably benign 0.01
R7390:Grik3 UTSW 4 125649739 missense probably damaging 1.00
R7604:Grik3 UTSW 4 125623635 missense probably damaging 0.97
R7790:Grik3 UTSW 4 125686019 missense probably damaging 1.00
R7822:Grik3 UTSW 4 125656397 critical splice donor site probably null
R7952:Grik3 UTSW 4 125704547 missense probably damaging 1.00
R8418:Grik3 UTSW 4 125686042 missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125656373 missense probably damaging 1.00
R9243:Grik3 UTSW 4 125707897 missense probably benign 0.00
Z1177:Grik3 UTSW 4 125650506 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGGGAATGTCAAAATCACTGC -3'
(R):5'- CTAATGTTGGGGCTCTGCTC -3'

Sequencing Primer
(F):5'- GGAATGTCAAAATCACTGCCCACTC -3'
(R):5'- GGGCTCTGCTCCCTCCC -3'
Posted On 2021-11-19