Incidental Mutation 'R9108:Nms'
ID 692052
Institutional Source Beutler Lab
Gene Symbol Nms
Ensembl Gene ENSMUSG00000067604
Gene Name neuromedin S
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R9108 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 38939149-38950276 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38946066 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000085346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088029] [ENSMUST00000160214]
AlphaFold Q5H8A1
Predicted Effect possibly damaging
Transcript: ENSMUST00000088029
AA Change: V91A

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085346
Gene: ENSMUSG00000067604
AA Change: V91A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160214
AA Change: V83A

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125166
Gene: ENSMUSG00000067604
AA Change: V83A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in the regulation of circadian rhythm, anorexigenic action, antidiuretic action, cardiovascular function and stimulation of oxytocin and vasopressin release. Mice lacking the encoded neuropeptide exhibit decreased heart rate without any accompanying changes in blood pressure. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature peptide. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G A 18: 6,638,794 V398M probably benign Het
4930568D16Rik G A 2: 35,354,930 P137S probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abcg8 A C 17: 84,692,815 I268L probably benign Het
Acvrl1 A G 15: 101,141,157 Q445R probably damaging Het
Adam17 T C 12: 21,330,131 N625D probably benign Het
Adamts9 C T 6: 92,880,740 V856M probably damaging Het
Adar T C 3: 89,736,167 C452R probably damaging Het
Adgra3 G T 5: 49,978,953 A730D probably damaging Het
Adnp2 C T 18: 80,142,710 R16Q probably damaging Het
Aox2 T C 1: 58,282,692 C48R probably damaging Het
Cabin1 T C 10: 75,657,139 E1774G possibly damaging Het
Capsl A T 15: 9,465,824 I199F possibly damaging Het
Ccdc191 T A 16: 43,898,149 D36E possibly damaging Het
Cep170 T A 1: 176,788,485 K86* probably null Het
Cnnm1 T C 19: 43,476,210 F736S possibly damaging Het
Col11a2 T A 17: 34,057,660 V532E probably benign Het
Dnmt3l T C 10: 78,056,922 probably null Het
Dzank1 C A 2: 144,522,471 V69L probably benign Het
Epor T G 9: 21,959,579 E335A probably damaging Het
Fbxo46 A T 7: 19,136,383 Y309F probably damaging Het
Gm14124 T A 2: 150,268,049 C220S possibly damaging Het
Gnptab C T 10: 88,433,538 S701L Het
Ifnl3 T C 7: 28,524,279 L180P probably benign Het
Ikzf2 T A 1: 69,538,797 I518F probably damaging Het
Ildr1 A G 16: 36,715,557 T145A probably benign Het
Kiss1r A T 10: 79,918,502 probably benign Het
Lhpp A G 7: 132,650,289 D219G probably damaging Het
Lrp1 A T 10: 127,554,337 M3071K probably damaging Het
Map6 T C 7: 99,336,896 L872P probably damaging Het
Mgst2 T A 3: 51,681,812 L82Q probably damaging Het
Mier2 A T 10: 79,541,922 V399E probably benign Het
Nt5dc2 T A 14: 31,135,059 Y145* probably null Het
Olfml2a A T 2: 38,941,741 M111L probably benign Het
Olfr487 T C 7: 108,211,639 N297D probably damaging Het
Olfr501-ps1 T A 7: 108,508,572 L172Q unknown Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plod3 T C 5: 136,989,163 I221T probably damaging Het
Polm T C 11: 5,829,872 Q342R probably benign Het
Ppp2r5c A T 12: 110,554,869 L275F probably damaging Het
Prdm12 C T 2: 31,643,917 T182M possibly damaging Het
Rasgrp2 G A 19: 6,408,860 V440M probably damaging Het
Rnf111 C T 9: 70,429,564 G947D probably damaging Het
Runx3 A T 4: 135,155,381 M143L probably damaging Het
Samd9l T C 6: 3,373,104 S1386G possibly damaging Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Shroom3 T C 5: 92,940,116 S242P probably damaging Het
Slc35e1 G A 8: 72,492,186 P134L Het
Spata31d1a A G 13: 59,703,168 V382A probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Trip10 C T 17: 57,253,519 A123V probably damaging Het
Trmt13 A G 3: 116,581,480 S460P probably damaging Het
Trpd52l3 A G 19: 30,003,929 N28S probably benign Het
Tubb4a A G 17: 57,081,232 F265L probably benign Het
Uba6 A T 5: 86,135,075 C581S possibly damaging Het
Uckl1 A G 2: 181,569,500 V512A probably damaging Het
Usp34 A T 11: 23,370,528 M957L Het
Vmn2r57 T C 7: 41,428,768 I89V possibly damaging Het
Zfp322a T C 13: 23,357,267 I102V probably benign Het
Zzef1 A G 11: 72,899,778 D2186G probably benign Het
Other mutations in Nms
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Nms APN 1 38946111 missense possibly damaging 0.92
IGL01959:Nms APN 1 38941925 splice site probably benign
IGL02088:Nms APN 1 38939277 utr 5 prime probably benign
IGL02810:Nms APN 1 38948644 missense possibly damaging 0.94
IGL03001:Nms APN 1 38941912 missense probably benign 0.12
alacrity UTSW 1 38941895 missense probably benign 0.04
R1087:Nms UTSW 1 38944111 critical splice donor site probably null
R3689:Nms UTSW 1 38946994 splice site probably benign
R4426:Nms UTSW 1 38939296 missense probably benign
R6910:Nms UTSW 1 38941895 missense probably benign 0.04
R7258:Nms UTSW 1 38946970 missense probably benign 0.01
R8848:Nms UTSW 1 38939310 missense probably benign
R9493:Nms UTSW 1 38941901 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAAACATTTCGAGCTTGGGC -3'
(R):5'- CTGGCAAAGTTAAACGACCAGTG -3'

Sequencing Primer
(F):5'- GGGCTCCGGAATTAATTTTAGTC -3'
(R):5'- AGTTAAACGACCAGTGTTTCTGCC -3'
Posted On 2021-12-30