Incidental Mutation 'R9108:Aox2'
ID 692053
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R9108 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58282692 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 48 (C48R)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably damaging
Transcript: ENSMUST00000114366
AA Change: C48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: C48R

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G A 18: 6,638,794 V398M probably benign Het
4930568D16Rik G A 2: 35,354,930 P137S probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abcg8 A C 17: 84,692,815 I268L probably benign Het
Acvrl1 A G 15: 101,141,157 Q445R probably damaging Het
Adam17 T C 12: 21,330,131 N625D probably benign Het
Adamts9 C T 6: 92,880,740 V856M probably damaging Het
Adar T C 3: 89,736,167 C452R probably damaging Het
Adgra3 G T 5: 49,978,953 A730D probably damaging Het
Adnp2 C T 18: 80,142,710 R16Q probably damaging Het
Cabin1 T C 10: 75,657,139 E1774G possibly damaging Het
Capsl A T 15: 9,465,824 I199F possibly damaging Het
Ccdc144b T G 3: 36,025,887 *240C probably null Het
Ccdc191 T A 16: 43,898,149 D36E possibly damaging Het
Cep170 T A 1: 176,788,485 K86* probably null Het
Cnnm1 T C 19: 43,476,210 F736S possibly damaging Het
Col11a2 T A 17: 34,057,660 V532E probably benign Het
Dnmt3l T C 10: 78,056,922 probably null Het
Dync1h1 T A 12: 110,656,272 probably benign Het
Dzank1 C A 2: 144,522,471 V69L probably benign Het
Epor T G 9: 21,959,579 E335A probably damaging Het
Fbxo46 A T 7: 19,136,383 Y309F probably damaging Het
Fra10ac1 A T 19: 38,214,331 probably benign Het
Gid8 G T 2: 180,710,339 probably benign Het
Gm14124 T A 2: 150,268,049 C220S possibly damaging Het
Gnptab C T 10: 88,433,538 S701L Het
Ifnl3 T C 7: 28,524,279 L180P probably benign Het
Ikzf2 T A 1: 69,538,797 I518F probably damaging Het
Ildr1 A G 16: 36,715,557 T145A probably benign Het
Kiss1r A T 10: 79,918,502 probably benign Het
Lhpp A G 7: 132,650,289 D219G probably damaging Het
Lrp1 A T 10: 127,554,337 M3071K probably damaging Het
Map6 T C 7: 99,336,896 L872P probably damaging Het
Mgst2 T A 3: 51,681,812 L82Q probably damaging Het
Mier2 A T 10: 79,541,922 V399E probably benign Het
Nms T C 1: 38,946,066 V91A possibly damaging Het
Nt5dc2 T A 14: 31,135,059 Y145* probably null Het
Olfml2a A T 2: 38,941,741 M111L probably benign Het
Olfr487 T C 7: 108,211,639 N297D probably damaging Het
Olfr501-ps1 T A 7: 108,508,572 L172Q unknown Het
Plod3 T C 5: 136,989,163 I221T probably damaging Het
Polm T C 11: 5,829,872 Q342R probably benign Het
Ppp2r5c A T 12: 110,554,869 L275F probably damaging Het
Prdm12 C T 2: 31,643,917 T182M possibly damaging Het
Rasgrp2 G A 19: 6,408,860 V440M probably damaging Het
Rnf111 C T 9: 70,429,564 G947D probably damaging Het
Runx3 A T 4: 135,155,381 M143L probably damaging Het
Samd9l T C 6: 3,373,104 S1386G possibly damaging Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Shroom3 T C 5: 92,940,116 S242P probably damaging Het
Slc35e1 G A 8: 72,492,186 P134L Het
Spata31d1a A G 13: 59,703,168 V382A probably benign Het
Tanc2 T A 11: 105,919,754 probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Trip10 C T 17: 57,253,519 A123V probably damaging Het
Trmt13 A G 3: 116,581,480 S460P probably damaging Het
Trpd52l3 A G 19: 30,003,929 N28S probably benign Het
Tubb4a A G 17: 57,081,232 F265L probably benign Het
Uba6 A T 5: 86,135,075 C581S possibly damaging Het
Uckl1 A G 2: 181,569,500 V512A probably damaging Het
Usp34 A T 11: 23,370,528 M957L Het
Vmn2r57 T C 7: 41,428,768 I89V possibly damaging Het
Zfp322a T C 13: 23,357,267 I102V probably benign Het
Zzef1 A G 11: 72,899,778 D2186G probably benign Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CGGGACCACATAGCTAAGCAATG -3'
(R):5'- GAAGGCCGTTAGCATAGTTACG -3'

Sequencing Primer
(F):5'- CAATGGCTTCTCAGACAGGGTG -3'
(R):5'- GGCCGTTAGCATAGTTACGTAATCAG -3'
Posted On 2021-12-30