Incidental Mutation 'R9108:Map6'
ID 692078
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms F-STOP, Mtap6, 2810411E12Rik, STOP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock # R9108 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 99267447-99337137 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99336896 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 872 (L872P)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: L872P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: L872P

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: L872P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably damaging
Transcript: ENSMUST00000208924
AA Change: L669P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G A 18: 6,638,794 V398M probably benign Het
4930568D16Rik G A 2: 35,354,930 P137S probably damaging Het
Abcb9 T C 5: 124,090,113 T22A possibly damaging Het
Abcg8 A C 17: 84,692,815 I268L probably benign Het
Acvrl1 A G 15: 101,141,157 Q445R probably damaging Het
Adam17 T C 12: 21,330,131 N625D probably benign Het
Adamts9 C T 6: 92,880,740 V856M probably damaging Het
Adar T C 3: 89,736,167 C452R probably damaging Het
Adgra3 G T 5: 49,978,953 A730D probably damaging Het
Adnp2 C T 18: 80,142,710 R16Q probably damaging Het
Aox2 T C 1: 58,282,692 C48R probably damaging Het
Cabin1 T C 10: 75,657,139 E1774G possibly damaging Het
Capsl A T 15: 9,465,824 I199F possibly damaging Het
Ccdc144b T G 3: 36,025,887 *240C probably null Het
Ccdc191 T A 16: 43,898,149 D36E possibly damaging Het
Cep170 T A 1: 176,788,485 K86* probably null Het
Cnnm1 T C 19: 43,476,210 F736S possibly damaging Het
Col11a2 T A 17: 34,057,660 V532E probably benign Het
Dnmt3l T C 10: 78,056,922 probably null Het
Dync1h1 T A 12: 110,656,272 probably benign Het
Dzank1 C A 2: 144,522,471 V69L probably benign Het
Epor T G 9: 21,959,579 E335A probably damaging Het
Fbxo46 A T 7: 19,136,383 Y309F probably damaging Het
Fra10ac1 A T 19: 38,214,331 probably benign Het
Gid8 G T 2: 180,710,339 probably benign Het
Gm14124 T A 2: 150,268,049 C220S possibly damaging Het
Gnptab C T 10: 88,433,538 S701L Het
Ifnl3 T C 7: 28,524,279 L180P probably benign Het
Ikzf2 T A 1: 69,538,797 I518F probably damaging Het
Ildr1 A G 16: 36,715,557 T145A probably benign Het
Kiss1r A T 10: 79,918,502 probably benign Het
Lhpp A G 7: 132,650,289 D219G probably damaging Het
Lrp1 A T 10: 127,554,337 M3071K probably damaging Het
Mgst2 T A 3: 51,681,812 L82Q probably damaging Het
Mier2 A T 10: 79,541,922 V399E probably benign Het
Nms T C 1: 38,946,066 V91A possibly damaging Het
Nt5dc2 T A 14: 31,135,059 Y145* probably null Het
Olfml2a A T 2: 38,941,741 M111L probably benign Het
Olfr487 T C 7: 108,211,639 N297D probably damaging Het
Olfr501-ps1 T A 7: 108,508,572 L172Q unknown Het
Plod3 T C 5: 136,989,163 I221T probably damaging Het
Polm T C 11: 5,829,872 Q342R probably benign Het
Ppp2r5c A T 12: 110,554,869 L275F probably damaging Het
Prdm12 C T 2: 31,643,917 T182M possibly damaging Het
Rasgrp2 G A 19: 6,408,860 V440M probably damaging Het
Rnf111 C T 9: 70,429,564 G947D probably damaging Het
Runx3 A T 4: 135,155,381 M143L probably damaging Het
Samd9l T C 6: 3,373,104 S1386G possibly damaging Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Shroom3 T C 5: 92,940,116 S242P probably damaging Het
Slc35e1 G A 8: 72,492,186 P134L Het
Spata31d1a A G 13: 59,703,168 V382A probably benign Het
Tanc2 T A 11: 105,919,754 probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Trip10 C T 17: 57,253,519 A123V probably damaging Het
Trmt13 A G 3: 116,581,480 S460P probably damaging Het
Trpd52l3 A G 19: 30,003,929 N28S probably benign Het
Tubb4a A G 17: 57,081,232 F265L probably benign Het
Uba6 A T 5: 86,135,075 C581S possibly damaging Het
Uckl1 A G 2: 181,569,500 V512A probably damaging Het
Usp34 A T 11: 23,370,528 M957L Het
Vmn2r57 T C 7: 41,428,768 I89V possibly damaging Het
Zfp322a T C 13: 23,357,267 I102V probably benign Het
Zzef1 A G 11: 72,899,778 D2186G probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0118:Map6 UTSW 7 99317617 missense possibly damaging 0.53
R0125:Map6 UTSW 7 99335980 splice site probably null
R0244:Map6 UTSW 7 99336836 missense probably benign 0.00
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0974:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R1455:Map6 UTSW 7 99268214 missense probably damaging 1.00
R1678:Map6 UTSW 7 99268098 missense probably damaging 1.00
R1696:Map6 UTSW 7 99317457 splice site probably null
R1866:Map6 UTSW 7 99315876 missense probably damaging 1.00
R2061:Map6 UTSW 7 99317472 missense probably damaging 1.00
R3236:Map6 UTSW 7 99336824 missense probably damaging 1.00
R3625:Map6 UTSW 7 99269195 missense possibly damaging 0.60
R4044:Map6 UTSW 7 99268049 missense probably damaging 1.00
R4570:Map6 UTSW 7 99336556 missense possibly damaging 0.49
R5056:Map6 UTSW 7 99336652 missense probably benign 0.05
R5065:Map6 UTSW 7 99336710 missense probably benign 0.02
R5656:Map6 UTSW 7 99336298 missense probably damaging 1.00
R6101:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6105:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6302:Map6 UTSW 7 99336107 missense probably damaging 0.99
R6450:Map6 UTSW 7 99268038 missense probably damaging 1.00
R6915:Map6 UTSW 7 99268247 missense probably damaging 1.00
R7205:Map6 UTSW 7 99269050 missense probably benign 0.00
R7223:Map6 UTSW 7 99268025 missense probably damaging 1.00
R7293:Map6 UTSW 7 99336533 missense possibly damaging 0.49
R7481:Map6 UTSW 7 99269138 missense possibly damaging 0.57
R7489:Map6 UTSW 7 99268061 missense probably damaging 1.00
R7691:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7693:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7695:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R8341:Map6 UTSW 7 99268440 missense possibly damaging 0.75
R8865:Map6 UTSW 7 99268985 missense probably benign 0.37
R8953:Map6 UTSW 7 99315871 missense probably damaging 1.00
R9173:Map6 UTSW 7 99268728 missense probably damaging 1.00
R9613:Map6 UTSW 7 99269177 missense possibly damaging 0.90
R9654:Map6 UTSW 7 99336959 missense probably damaging 1.00
Z1176:Map6 UTSW 7 99317660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCAAGGTCCAGTGATCC -3'
(R):5'- TATGACTTTGCCTCCCCAGAAG -3'

Sequencing Primer
(F):5'- TGATCCCTGAGCCAGTGAAG -3'
(R):5'- TCCGTATGGGGAACTGTT -3'
Posted On 2021-12-30