Incidental Mutation 'R9073:Olfr1466'
ID 692919
Institutional Source Beutler Lab
Gene Symbol Olfr1466
Ensembl Gene ENSMUSG00000096485
Gene Name olfactory receptor 1466
Synonyms MOR202-12, GA_x6K02T2RE5P-3672907-3673839
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R9073 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 13338862-13343572 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13341874 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 39 (T39A)
Ref Sequence ENSEMBL: ENSMUSP00000147188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075868] [ENSMUST00000207124]
AlphaFold Q8VFW4
Predicted Effect possibly damaging
Transcript: ENSMUST00000075868
AA Change: T39A

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075265
Gene: ENSMUSG00000096485
AA Change: T39A

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 4.1e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1.9e-6 PFAM
Pfam:7tm_1 42 291 7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207124
AA Change: T39A

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,944,392 Y190* probably null Het
Agbl3 T C 6: 34,799,452 C298R probably damaging Het
Ankrd26 T A 6: 118,523,389 K1040N probably damaging Het
Ano3 T A 2: 110,745,898 T93S probably benign Het
Apoc3 T A 9: 46,233,234 I97F probably benign Het
Arid5a A G 1: 36,319,545 E401G probably benign Het
Atxn3 T C 12: 101,937,471 probably null Het
Brca1 C T 11: 101,502,480 probably null Het
C1ql3 T A 2: 13,010,387 N154I probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Ccdc110 A T 8: 45,942,838 M589L probably benign Het
Ccnb2 A T 9: 70,410,813 F226I possibly damaging Het
Commd8 TTGTCATCT TT 5: 72,160,984 probably null Het
Dis3 T C 14: 99,095,211 T262A probably benign Het
Eif4a2 G A 16: 23,110,653 R234Q probably benign Het
Ephx2 G A 14: 66,086,239 R481* probably null Het
Fbxo15 T C 18: 84,965,520 I331T possibly damaging Het
Gfra2 A G 14: 70,901,495 E121G possibly damaging Het
Git1 G A 11: 77,499,075 A55T probably benign Het
Hfm1 T C 5: 106,898,280 I553V probably benign Het
Hydin G A 8: 110,267,451 probably null Het
Iqgap3 A G 3: 88,109,466 N1085S Het
Kbtbd12 T C 6: 88,618,440 Y136C probably damaging Het
Kcng3 A G 17: 83,630,994 Y209H possibly damaging Het
Kcnj2 A T 11: 111,071,838 M19L possibly damaging Het
Lonrf2 A T 1: 38,811,786 F232I probably damaging Het
Lrrc31 T C 3: 30,699,710 D14G probably benign Het
Ly6l G A 15: 75,449,736 V62I possibly damaging Het
March8 T C 6: 116,401,923 F273L probably benign Het
Masp1 A C 16: 23,469,921 S710A probably benign Het
Mcm10 G A 2: 5,008,603 R73C possibly damaging Het
Mcm5 G A 8: 75,126,306 R682H probably damaging Het
Mink1 C T 11: 70,608,381 T684I possibly damaging Het
Mocos A T 18: 24,664,032 Q83L probably damaging Het
Nags T C 11: 102,147,521 L351P probably damaging Het
Nalcn G A 14: 123,295,451 T1299I possibly damaging Het
Nlrp4b A G 7: 10,725,943 D824G probably benign Het
Nwd1 A T 8: 72,695,418 M1031L probably benign Het
Olfr1164 T A 2: 88,093,828 Q36L probably benign Het
Olfr1188 A C 2: 88,560,314 I271L probably benign Het
Olfr1286 A T 2: 111,420,360 I197N possibly damaging Het
Olfr657 C T 7: 104,636,084 R137C probably benign Het
Olfr743 C T 14: 50,533,754 T114I probably benign Het
Pan2 T C 10: 128,315,181 M807T probably damaging Het
Parp8 A T 13: 116,911,415 I222N probably damaging Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pou1f1 T C 16: 65,531,947 L186P Het
Ppargc1b G A 18: 61,310,659 R494W probably damaging Het
Prg4 G T 1: 150,455,537 P462T unknown Het
Ptcd1 T A 5: 145,154,715 I525L probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pum1 T C 4: 130,752,861 F693S probably damaging Het
Ribc2 A C 15: 85,137,962 Q186P probably damaging Het
Sesn2 C A 4: 132,496,884 probably null Het
Sgf29 G A 7: 126,672,654 V284M probably damaging Het
Skap2 C T 6: 51,879,770 probably null Het
Smap1 T A 1: 23,922,073 E28V probably damaging Het
Smc3 A G 19: 53,628,769 N538D probably benign Het
Spen T C 4: 141,476,391 T1642A unknown Het
Spred3 G A 7: 29,166,530 R115* probably null Het
Srrm4 TTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTT 5: 116,475,202 probably benign Het
Sugt1 T A 14: 79,628,853 M304K possibly damaging Het
Sval1 T C 6: 41,951,672 I6T possibly damaging Het
Svil T C 18: 5,097,500 I1574T probably benign Het
Tinag T A 9: 76,997,018 probably null Het
Trak1 T C 9: 121,460,488 L622P probably damaging Het
Ttn C T 2: 76,755,874 D21838N probably damaging Het
Ttn ACCTCCTCCTCCTCCTCCTC ACCTCCTCCTCCTCCTC 2: 76,843,390 probably benign Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn1r73 C T 7: 11,756,276 A7V probably benign Het
Yy1 G T 12: 108,793,995 G195C probably benign Het
Zbtb17 T A 4: 141,466,365 C607S possibly damaging Het
Zfp735 T C 11: 73,712,234 V668A probably benign Het
Zfp819 C A 7: 43,617,146 T351K probably damaging Het
Zfp820 C A 17: 21,820,050 S99I possibly damaging Het
Other mutations in Olfr1466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Olfr1466 APN 19 13342120 missense probably benign 0.13
IGL02568:Olfr1466 APN 19 13342219 missense probably benign 0.08
IGL03073:Olfr1466 APN 19 13342022 missense probably benign 0.00
R0943:Olfr1466 UTSW 19 13341793 missense probably benign 0.00
R1301:Olfr1466 UTSW 19 13341847 missense probably benign 0.05
R1355:Olfr1466 UTSW 19 13342518 nonsense probably null
R1524:Olfr1466 UTSW 19 13342122 nonsense probably null
R1568:Olfr1466 UTSW 19 13342175 missense probably benign 0.14
R1993:Olfr1466 UTSW 19 13341814 missense possibly damaging 0.65
R2031:Olfr1466 UTSW 19 13342406 missense probably benign 0.18
R3693:Olfr1466 UTSW 19 13342529 missense possibly damaging 0.73
R3694:Olfr1466 UTSW 19 13342529 missense possibly damaging 0.73
R3853:Olfr1466 UTSW 19 13342498 missense possibly damaging 0.55
R5313:Olfr1466 UTSW 19 13342065 missense probably benign 0.07
R5467:Olfr1466 UTSW 19 13342157 missense probably damaging 1.00
R6060:Olfr1466 UTSW 19 13342133 missense probably benign 0.08
R7125:Olfr1466 UTSW 19 13341739 critical splice acceptor site probably null
R7591:Olfr1466 UTSW 19 13342255 missense probably benign 0.28
R9072:Olfr1466 UTSW 19 13341874 missense possibly damaging 0.80
Z1177:Olfr1466 UTSW 19 13342255 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGTCACAGCAATGTGTAGGATATTG -3'
(R):5'- GAACATCTGAGCTGCACACTC -3'

Sequencing Primer
(F):5'- CAGCAATGTGTAGGATATTGTAGAG -3'
(R):5'- CTGAGCTGCACACTCATTGTAAG -3'
Posted On 2021-12-30