Incidental Mutation 'R7591:Olfr1466'
ID587428
Institutional Source Beutler Lab
Gene Symbol Olfr1466
Ensembl Gene ENSMUSG00000096485
Gene Nameolfactory receptor 1466
SynonymsMOR202-12, GA_x6K02T2RE5P-3672907-3673839
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7591 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13338862-13343572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13342255 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 166 (S166G)
Ref Sequence ENSEMBL: ENSMUSP00000147188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075868] [ENSMUST00000207124]
Predicted Effect probably benign
Transcript: ENSMUST00000075868
AA Change: S166G

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075265
Gene: ENSMUSG00000096485
AA Change: S166G

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 4.1e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1.9e-6 PFAM
Pfam:7tm_1 42 291 7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207124
AA Change: S166G

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C A 10: 82,292,212 V1655F probably benign Het
Ccne2 T C 4: 11,201,393 I307T probably benign Het
Chrm3 A T 13: 9,877,313 C562* probably null Het
Cldn11 A T 3: 31,150,287 E46D probably benign Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dbh A G 2: 27,170,510 T233A probably damaging Het
Dennd2c T A 3: 103,133,345 Y309N possibly damaging Het
Dnttip2 T A 3: 122,276,468 L444* probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epop A T 11: 97,628,332 V317E probably damaging Het
Eppk1 T C 15: 76,107,597 T1695A possibly damaging Het
Fam149a T A 8: 45,350,435 I421F possibly damaging Het
Gm13103 A T 4: 143,850,911 I88L probably benign Het
Impa2 T C 18: 67,318,410 L258P probably damaging Het
Itga1 G A 13: 114,982,779 R855W probably damaging Het
Kcnh5 T C 12: 75,007,767 T468A probably benign Het
Kif11 A G 19: 37,384,263 K33R probably damaging Het
Lamb1 C A 12: 31,326,648 A1657E probably damaging Het
Macc1 T C 12: 119,446,658 V387A probably damaging Het
Nalcn T C 14: 123,323,885 T734A probably benign Het
Nphp3 T C 9: 104,018,278 probably null Het
Nutm2 A G 13: 50,473,867 I461M probably damaging Het
Olfr1178 G A 2: 88,391,876 V210M probably benign Het
Olfr1191-ps1 A C 2: 88,643,467 K233N probably damaging Het
Olfr465-ps1 T C 13: 65,144,648 F130L probably benign Het
Pigo T C 4: 43,025,093 N2S probably benign Het
Plcl1 A T 1: 55,697,449 I650L probably benign Het
Ppcdc A T 9: 57,434,979 V20D probably damaging Het
Rhobtb2 A G 14: 69,799,741 V78A possibly damaging Het
Rp1l1 T C 14: 64,026,109 V226A probably damaging Het
Scrt1 C A 15: 76,519,494 G99C probably damaging Het
Skint9 A T 4: 112,390,950 I199N probably damaging Het
Slc5a4a T C 10: 76,147,667 probably benign Het
Smad3 C T 9: 63,654,717 W326* probably null Het
Spata18 A T 5: 73,672,416 I305F Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Syne3 A G 12: 104,940,604 probably null Het
Trim69 G A 2: 122,167,973 R142Q probably benign Het
Vmn1r40 A T 6: 89,714,773 I191F probably benign Het
Vmn2r16 T A 5: 109,362,357 D535E probably damaging Het
Vwa5b2 A G 16: 20,601,567 E742G probably damaging Het
Zfp442 A T 2: 150,408,172 Y603* probably null Het
Zp1 T C 19: 10,919,471 N68S probably damaging Het
Other mutations in Olfr1466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Olfr1466 APN 19 13342120 missense probably benign 0.13
IGL02568:Olfr1466 APN 19 13342219 missense probably benign 0.08
IGL03073:Olfr1466 APN 19 13342022 missense probably benign 0.00
R0943:Olfr1466 UTSW 19 13341793 missense probably benign 0.00
R1301:Olfr1466 UTSW 19 13341847 missense probably benign 0.05
R1355:Olfr1466 UTSW 19 13342518 nonsense probably null
R1524:Olfr1466 UTSW 19 13342122 nonsense probably null
R1568:Olfr1466 UTSW 19 13342175 missense probably benign 0.14
R1993:Olfr1466 UTSW 19 13341814 missense possibly damaging 0.65
R2031:Olfr1466 UTSW 19 13342406 missense probably benign 0.18
R3693:Olfr1466 UTSW 19 13342529 missense possibly damaging 0.73
R3694:Olfr1466 UTSW 19 13342529 missense possibly damaging 0.73
R3853:Olfr1466 UTSW 19 13342498 missense possibly damaging 0.55
R5313:Olfr1466 UTSW 19 13342065 missense probably benign 0.07
R5467:Olfr1466 UTSW 19 13342157 missense probably damaging 1.00
R6060:Olfr1466 UTSW 19 13342133 missense probably benign 0.08
R7125:Olfr1466 UTSW 19 13341739 critical splice acceptor site probably null
Z1177:Olfr1466 UTSW 19 13342255 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GAGTGTGCAGCTCAGATGTTC -3'
(R):5'- TGAACTCCTGCTTCTGAGTGC -3'

Sequencing Primer
(F):5'- TGCAGCAGTGTGTAAACC -3'
(R):5'- CTGCTTCTGAGTGCATCTTTAAG -3'
Posted On2019-10-24