Incidental Mutation 'R9127:1700014D04Rik'
ID 693355
Institutional Source Beutler Lab
Gene Symbol 1700014D04Rik
Ensembl Gene ENSMUSG00000051054
Gene Name RIKEN cDNA 1700014D04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R9127 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 59740842-59746752 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59743014 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 331 (S331P)
Ref Sequence ENSEMBL: ENSMUSP00000136424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055343] [ENSMUST00000178508] [ENSMUST00000180139]
AlphaFold J3QMS2
Predicted Effect probably benign
Transcript: ENSMUST00000055343
SMART Domains Protein: ENSMUSP00000052403
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178508
SMART Domains Protein: ENSMUSP00000136897
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
Pfam:FAM75 66 99 7.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180139
AA Change: S331P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136424
Gene: ENSMUSG00000051054
AA Change: S331P

DomainStartEndE-ValueType
Pfam:FAM75 66 439 6.9e-97 PFAM
low complexity region 622 633 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
low complexity region 737 763 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A T 10: 82,622,754 M21K probably benign Het
1700029J07Rik T G 8: 45,962,366 D201A probably benign Het
Abca13 T G 11: 9,292,080 D1314E probably benign Het
Abcb1a A T 5: 8,674,707 R47W probably benign Het
Abcc6 T C 7: 45,979,760 N1354S probably damaging Het
Abracl T C 10: 18,011,696 Y61C probably damaging Het
Adamtsl1 A G 4: 86,289,790 T633A probably benign Het
Ago4 A T 4: 126,507,111 M647K probably damaging Het
Akap7 G T 10: 25,279,778 S72R unknown Het
Arhgef12 A G 9: 42,974,574 L1251S possibly damaging Het
Astn2 A T 4: 66,403,927 V145E unknown Het
Atxn2l A T 7: 126,498,221 S304R probably damaging Het
Cd226 A T 18: 89,269,031 I318F probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chtf8 A G 8: 106,887,008 V18A probably benign Het
Cit G T 5: 115,936,837 E683* probably null Het
Ckmt2 T C 13: 91,859,218 R286G probably damaging Het
Clec4a2 T A 6: 123,139,259 W128R probably damaging Het
Clec4n T G 6: 123,235,488 S88A probably damaging Het
Cndp2 G A 18: 84,680,996 A48V probably benign Het
Csmd1 T C 8: 16,223,272 T849A probably benign Het
Cts3 A T 13: 61,567,421 Y199* probably null Het
Dag1 A T 9: 108,208,535 L469* probably null Het
Dclre1c T C 2: 3,438,088 V225A Het
Dedd A G 1: 171,338,841 D115G probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
E330014E10Rik A G 5: 95,803,764 Y470C probably damaging Het
Eif2ak3 T A 6: 70,883,720 W427R probably damaging Het
Fbln2 T A 6: 91,233,491 V139D probably damaging Het
Fbn1 A T 2: 125,382,065 M588K possibly damaging Het
Gm11639 T A 11: 104,850,581 V2166D probably benign Het
Gm17019 A T 5: 15,031,099 Y109* probably null Het
Gm32742 T A 9: 51,144,715 N1255Y probably damaging Het
Gm5431 T A 11: 48,888,773 K441* probably null Het
Golga2 A G 2: 32,306,067 D898G Het
Gramd4 G A 15: 86,091,324 R39H probably benign Het
Gucy1a2 A G 9: 3,634,553 N199S probably damaging Het
Heyl G A 4: 123,246,092 R148H probably damaging Het
Ifi208 A T 1: 173,695,834 M557L probably benign Het
Igf2r A G 17: 12,739,351 V145A probably damaging Het
Ighv1-4 A T 12: 114,487,259 Y76* probably null Het
Ikzf4 T C 10: 128,632,618 D664G unknown Het
Il1a T A 2: 129,304,795 Y126F possibly damaging Het
Lmf2 C A 15: 89,355,568 probably benign Het
Lyst T C 13: 13,634,242 S166P probably damaging Het
Mgat5 A C 1: 127,366,460 T180P probably benign Het
Mical2 A C 7: 112,271,382 K26T possibly damaging Het
Mov10 G T 3: 104,804,343 Y209* probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Numa1 T A 7: 101,992,662 S106T possibly damaging Het
Olfr1232 G A 2: 89,326,130 Q17* probably null Het
Olfr1461 A G 19: 13,165,032 N6S probably damaging Het
Olfr396-ps1 A T 11: 73,928,341 E39V probably damaging Het
Olfr845 A G 9: 19,338,730 H90R probably benign Het
Pcdhb14 A G 18: 37,449,038 N399S probably damaging Het
Plcl2 T A 17: 50,611,004 S944T probably benign Het
Pml A T 9: 58,220,377 I695N probably benign Het
Ppard G T 17: 28,286,375 R12L unknown Het
Ppip5k1 C T 2: 121,327,644 probably null Het
Ppp1r3g T C 13: 35,968,638 S14P probably benign Het
Prrc2b C A 2: 32,213,752 R1081S probably damaging Het
Rasgrp2 A T 19: 6,404,408 E160D possibly damaging Het
Rb1cc1 G A 1: 6,262,849 V1331I probably damaging Het
Rnd3 A T 2: 51,132,401 S210T probably benign Het
Scaf11 T C 15: 96,414,883 T1426A probably benign Het
Sin3b C T 8: 72,733,406 T207I possibly damaging Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc28a3 C T 13: 58,576,767 M224I probably benign Het
Slc30a1 T C 1: 191,907,230 I75T probably damaging Het
Slco2a1 T A 9: 103,068,044 L206Q probably damaging Het
Sptbn1 A G 11: 30,154,356 V116A probably damaging Het
Syngap1 G A 17: 26,962,121 D1008N probably damaging Het
Syt11 T C 3: 88,762,336 D83G probably benign Het
Syt14 G A 1: 192,901,823 T428I probably damaging Het
Taf15 T A 11: 83,504,259 Y338* probably null Het
Tfap4 A T 16: 4,547,319 M253K possibly damaging Het
Tnr T C 1: 159,886,110 S703P possibly damaging Het
Trrap G A 5: 144,831,020 D2577N probably benign Het
Wdr20 C T 12: 110,793,163 S161L possibly damaging Het
Zfp503 C A 14: 21,987,350 V62L probably benign Het
Other mutations in 1700014D04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB010:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
BB020:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R0838:1700014D04Rik UTSW 13 59742468 missense possibly damaging 0.75
R1483:1700014D04Rik UTSW 13 59742903 missense probably damaging 0.99
R1794:1700014D04Rik UTSW 13 59742620 missense probably benign 0.22
R1842:1700014D04Rik UTSW 13 59742506 missense probably damaging 1.00
R1969:1700014D04Rik UTSW 13 59742785 missense probably damaging 0.98
R2027:1700014D04Rik UTSW 13 59742587 missense possibly damaging 0.48
R2206:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2207:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2882:1700014D04Rik UTSW 13 59742943 missense probably benign 0.00
R3508:1700014D04Rik UTSW 13 59742505 nonsense probably null
R4447:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R4560:1700014D04Rik UTSW 13 59741757 missense probably damaging 1.00
R4846:1700014D04Rik UTSW 13 59742233 missense probably benign 0.00
R5186:1700014D04Rik UTSW 13 59743739 missense probably damaging 1.00
R5510:1700014D04Rik UTSW 13 59742420 splice site probably null
R5580:1700014D04Rik UTSW 13 59742256 missense probably benign 0.00
R5752:1700014D04Rik UTSW 13 59743202 missense probably damaging 0.96
R6266:1700014D04Rik UTSW 13 59742312 missense probably benign 0.33
R6267:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6296:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6939:1700014D04Rik UTSW 13 59742058 missense possibly damaging 0.75
R6973:1700014D04Rik UTSW 13 59742707 missense probably benign 0.14
R7107:1700014D04Rik UTSW 13 59742183 nonsense probably null
R7123:1700014D04Rik UTSW 13 59743440 nonsense probably null
R7254:1700014D04Rik UTSW 13 59741976 missense probably benign 0.01
R7354:1700014D04Rik UTSW 13 59741834 nonsense probably null
R7536:1700014D04Rik UTSW 13 59741742 missense probably damaging 0.99
R7729:1700014D04Rik UTSW 13 59741623 missense not run
R7912:1700014D04Rik UTSW 13 59742515 missense probably damaging 1.00
R7933:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R8029:1700014D04Rik UTSW 13 59742377 missense possibly damaging 0.79
R8347:1700014D04Rik UTSW 13 59742236 missense possibly damaging 0.63
R8370:1700014D04Rik UTSW 13 59743952 missense probably benign
R8395:1700014D04Rik UTSW 13 59741726 missense probably benign 0.00
R8508:1700014D04Rik UTSW 13 59743598 missense probably benign 0.02
R8930:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R8932:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R9262:1700014D04Rik UTSW 13 59742588 missense probably benign 0.00
R9401:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R9514:1700014D04Rik UTSW 13 59742992 missense probably damaging 0.96
X0024:1700014D04Rik UTSW 13 59742725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAAGCTAGTCCTTGAGTGAC -3'
(R):5'- GAACAACCTGGACCCCTATG -3'

Sequencing Primer
(F):5'- AGTCCTTGAGTGACACACTG -3'
(R):5'- GGACCCCTATGGACCAAAC -3'
Posted On 2022-01-20