Incidental Mutation 'R0748:Htr2b'
ID 70210
Institutional Source Beutler Lab
Gene Symbol Htr2b
Ensembl Gene ENSMUSG00000026228
Gene Name 5-hydroxytryptamine (serotonin) receptor 2B
Synonyms 5-HT2B
Accession Numbers
Essential gene? Possibly essential (E-score: 0.564) question?
Stock # R0748 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 86099026-86111970 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86110806 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 26 (I26T)
Ref Sequence ENSEMBL: ENSMUSP00000027431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027431] [ENSMUST00000027432] [ENSMUST00000139715] [ENSMUST00000155077]
AlphaFold Q02152
Predicted Effect probably benign
Transcript: ENSMUST00000027431
AA Change: I26T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027431
Gene: ENSMUSG00000026228
AA Change: I26T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 63 394 5.9e-12 PFAM
Pfam:7tm_1 70 379 4.5e-65 PFAM
low complexity region 447 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027432
SMART Domains Protein: ENSMUSP00000027432
Gene: ENSMUSG00000026229

DomainStartEndE-ValueType
Pfam:PC_rep 441 474 5.1e-9 PFAM
Pfam:PC_rep 476 510 8.4e-8 PFAM
Pfam:PC_rep 511 545 1.1e-7 PFAM
Pfam:HEAT_2 599 693 3.3e-15 PFAM
Pfam:PC_rep 651 685 1.1e-11 PFAM
low complexity region 818 828 N/A INTRINSIC
low complexity region 837 872 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152184
Predicted Effect probably benign
Transcript: ENSMUST00000155077
SMART Domains Protein: ENSMUSP00000116273
Gene: ENSMUSG00000026228

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 1 125 8.2e-8 PFAM
Pfam:7TM_GPCR_Srx 1 128 1.1e-6 PFAM
Pfam:7tm_1 1 172 6e-40 PFAM
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the several different receptors for 5-hydroxytryptamine (serotonin) that belongs to the G-protein coupled receptor 1 family. Serotonin is a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. Serotonin receptors mediate many of the central and peripheral physiologic functions of serotonin, including regulation of cardiovascular functions and impulsive behavior. Population and family-based analyses of a minor allele (glutamine-to-stop substitution, designated Q20*) which blocks expression of this protein, and knockout studies in mice, suggest a role for this gene in impulsivity. However, other factors, such as elevated testosterone levels, may also be involved. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a lack of cardiac trabeculae, ventricular hypoplasia due to impaired myocyte proliferation, and midgestational and neonatal lethality of variable severity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,876 V718A probably damaging Het
Amigo1 A G 3: 108,188,630 S482G probably damaging Het
F2rl3 A G 8: 72,762,751 Q202R probably benign Het
Faap100 A G 11: 120,372,171 V787A probably damaging Het
Fat4 A T 3: 38,887,828 Q290L possibly damaging Het
Flnc A G 6: 29,446,344 E920G probably damaging Het
Gm9881 T C 16: 91,170,425 N137S unknown Het
Hps4 A G 5: 112,374,914 E546G probably damaging Het
Insr A C 8: 3,258,841 M65R probably damaging Het
Kif20a T C 18: 34,628,188 probably benign Het
L3mbtl1 A T 2: 162,971,163 probably benign Het
L3mbtl1 A C 2: 162,971,164 probably null Het
Lcn4 T C 2: 26,668,347 I175M probably damaging Het
Malt1 T A 18: 65,475,260 probably null Het
Nufip1 T C 14: 76,111,068 S46P probably damaging Het
Nup93 T A 8: 94,307,943 Y629N probably damaging Het
Olfr517 C A 7: 108,869,150 M1I probably null Het
Pcsk6 T C 7: 66,038,968 probably benign Het
Rdx G C 9: 52,064,860 V33L possibly damaging Het
Rnf213 T C 11: 119,473,480 L4535P probably damaging Het
Rorb T A 19: 18,977,800 T66S probably damaging Het
S100a9 T C 3: 90,692,891 D66G possibly damaging Het
Sacs T C 14: 61,209,265 I2920T probably damaging Het
Safb2 T C 17: 56,575,580 N351S probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Unc13b G A 4: 43,241,164 probably benign Het
Vars A G 17: 34,998,012 S489P probably damaging Het
Wars2 A G 3: 99,216,572 K250E probably damaging Het
Zfp292 A G 4: 34,816,424 probably benign Het
Other mutations in Htr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02434:Htr2b APN 1 86110770 missense probably benign
IGL03239:Htr2b APN 1 86099692 missense probably damaging 1.00
IGL03303:Htr2b APN 1 86099339 unclassified probably benign
P0035:Htr2b UTSW 1 86110730 missense probably benign
R0655:Htr2b UTSW 1 86110843 missense probably benign
R1311:Htr2b UTSW 1 86110624 missense probably damaging 1.00
R1848:Htr2b UTSW 1 86099429 missense possibly damaging 0.90
R1916:Htr2b UTSW 1 86099801 missense probably damaging 1.00
R2938:Htr2b UTSW 1 86102455 missense possibly damaging 0.74
R4959:Htr2b UTSW 1 86100091 missense probably damaging 1.00
R6501:Htr2b UTSW 1 86110641 missense probably damaging 1.00
R6508:Htr2b UTSW 1 86102464 missense possibly damaging 0.94
R6841:Htr2b UTSW 1 86099893 missense probably benign 0.45
R8247:Htr2b UTSW 1 86100095 missense probably benign
R8275:Htr2b UTSW 1 86102572 missense probably damaging 1.00
R9098:Htr2b UTSW 1 86099759 missense probably damaging 1.00
R9352:Htr2b UTSW 1 86099572 missense probably benign 0.07
R9379:Htr2b UTSW 1 86100122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTTTCTCCAGTGCAACAGCC -3'
(R):5'- AGTCCCATCTTCGAGAGCCTGAATC -3'

Sequencing Primer
(F):5'- GCCAGAATCACAAGGATGTTCC -3'
(R):5'- AAGAAGTCACCTTGGCTGTG -3'
Posted On 2013-09-30