Incidental Mutation 'R9317:Smarca2'
ID 705934
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms Snf2l2, brm, 2610209L14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9317 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 26605050-26778322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26759879 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 65 (C65R)
Ref Sequence ENSEMBL: ENSMUSP00000135412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000112637] [ENSMUST00000175791] [ENSMUST00000175842] [ENSMUST00000175953] [ENSMUST00000176030] [ENSMUST00000176475] [ENSMUST00000176698] [ENSMUST00000176731] [ENSMUST00000176769] [ENSMUST00000177252] [ENSMUST00000207054] [ENSMUST00000207118] [ENSMUST00000207812] [ENSMUST00000207832] [ENSMUST00000208027] [ENSMUST00000208091] [ENSMUST00000208186] [ENSMUST00000208226] [ENSMUST00000208541] [ENSMUST00000208589] [ENSMUST00000208705] [ENSMUST00000208712] [ENSMUST00000208751] [ENSMUST00000208915] [ENSMUST00000209085]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025862
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099537
AA Change: C1412R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: C1412R

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112637
SMART Domains Protein: ENSMUSP00000108256
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 154 3.13e-41 SMART
low complexity region 155 177 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175791
AA Change: C65R

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135412
Gene: ENSMUSG00000024921
AA Change: C65R

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 172 1.74e-39 SMART
low complexity region 173 195 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175842
SMART Domains Protein: ENSMUSP00000135800
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
BROMO 84 212 1.74e-39 SMART
low complexity region 213 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175953
SMART Domains Protein: ENSMUSP00000135042
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
SCOP:d1jb0a_ 16 80 5e-3 SMART
PDB:2DAT|A 42 83 3e-23 PDB
Blast:BROMO 44 83 3e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000176030
AA Change: C1412R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: C1412R

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176475
SMART Domains Protein: ENSMUSP00000135248
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
BROMO 84 194 3.13e-41 SMART
low complexity region 195 217 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176698
AA Change: C65R

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134914
Gene: ENSMUSG00000024921
AA Change: C65R

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 172 1.74e-39 SMART
low complexity region 173 195 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176731
SMART Domains Protein: ENSMUSP00000135460
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
PDB:2DAT|A 10 33 8e-9 PDB
Blast:BROMO 12 35 6e-7 BLAST
low complexity region 83 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176769
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177252
SMART Domains Protein: ENSMUSP00000134995
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 154 3.13e-41 SMART
low complexity region 155 177 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207054
Predicted Effect probably benign
Transcript: ENSMUST00000207118
Predicted Effect possibly damaging
Transcript: ENSMUST00000207535
AA Change: C36R

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000207812
Predicted Effect probably benign
Transcript: ENSMUST00000207832
Predicted Effect possibly damaging
Transcript: ENSMUST00000208027
AA Change: C105R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000208091
Predicted Effect possibly damaging
Transcript: ENSMUST00000208186
AA Change: C105R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000208226
Predicted Effect probably benign
Transcript: ENSMUST00000208541
Predicted Effect probably benign
Transcript: ENSMUST00000208589
Predicted Effect probably benign
Transcript: ENSMUST00000208674
Predicted Effect possibly damaging
Transcript: ENSMUST00000208705
AA Change: C65R

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000208712
Predicted Effect probably benign
Transcript: ENSMUST00000208751
Predicted Effect probably benign
Transcript: ENSMUST00000208915
Predicted Effect probably benign
Transcript: ENSMUST00000209085
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad2 T C 8: 119,615,441 L307P probably damaging Het
Apcdd1 C T 18: 62,922,660 probably benign Het
C130060K24Rik A C 6: 65,447,384 I174L probably benign Het
C1qbp T C 11: 70,978,103 N278D probably benign Het
Cd68 C T 11: 69,665,034 probably null Het
Cdc37l1 T G 19: 28,995,118 N70K probably damaging Het
Cyp3a57 T C 5: 145,372,611 V253A possibly damaging Het
Dnmt1 A G 9: 20,918,279 F795S probably damaging Het
Gli3 T A 13: 15,715,073 S591T probably damaging Het
Gmeb1 A T 4: 132,226,038 S472R probably benign Het
Gpr158 T C 2: 21,827,226 S1046P probably benign Het
Grik5 A G 7: 25,046,235 L471P probably damaging Het
Hmcn2 G A 2: 31,460,316 R5075H possibly damaging Het
Hspa5 G T 2: 34,776,058 S638I probably benign Het
Ilf3 A G 9: 21,396,126 Y355C probably damaging Het
Kalrn T C 16: 34,013,675 T2366A Het
Negr1 T A 3: 157,198,444 C315S probably benign Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr917 T A 9: 38,665,359 M162L probably benign Het
Prr5 C T 15: 84,699,123 Q110* probably null Het
Prune2 T A 19: 17,121,670 S1513T probably benign Het
Ptprk A G 10: 28,354,735 E274G probably damaging Het
Rmdn3 G A 2: 119,156,510 A12V unknown Het
Rpf1 A G 3: 146,512,261 V166A probably benign Het
Senp5 A C 16: 31,983,572 F554C probably damaging Het
Sprr2j-ps T A 3: 92,418,871 C18S unknown Het
Sult2a6 A T 7: 14,236,690 Y160* probably null Het
Taar8a T C 10: 24,076,855 V119A probably benign Het
Tmtc3 T C 10: 100,466,034 K351R probably benign Het
Trpc1 A G 9: 95,721,222 L419P probably damaging Het
Ttn T C 2: 76,811,355 K13466E possibly damaging Het
Unc13c A G 9: 73,540,380 F1846S possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vmn2r72 A T 7: 85,754,814 N56K probably benign Het
Wdr12 C A 1: 60,089,296 M98I probably benign Het
Zfp953 T C 13: 67,343,393 Y165C possibly damaging Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26774294 missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26698465 missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26716137 missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26672740 missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26716182 missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26640586 missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26676624 splice site probably benign
IGL03028:Smarca2 APN 19 26678312 splice site probably benign
IGL03187:Smarca2 APN 19 26672824 missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26623975 missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26619903 missense probably benign 0.01
Genghis UTSW 19 26619884 missense possibly damaging 0.53
kraft UTSW 19 26678363 missense probably damaging 0.99
Kublai UTSW 19 26640613 missense probably damaging 1.00
Samarkand UTSW 19 26654464 nonsense probably null
tashkent UTSW 19 26720873 missense probably benign 0.06
Xanadu UTSW 19 26682052 missense possibly damaging 0.52
FR4737:Smarca2 UTSW 19 26630999 unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26649093 missense probably benign 0.35
R0184:Smarca2 UTSW 19 26692249 nonsense probably null
R0306:Smarca2 UTSW 19 26640613 missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26691362 missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26681875 missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26691391 missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26706200 missense possibly damaging 0.51
R0726:Smarca2 UTSW 19 26698403 missense probably damaging 1.00
R1184:Smarca2 UTSW 19 26770933 splice site probably benign
R1256:Smarca2 UTSW 19 26681973 missense probably benign 0.06
R1299:Smarca2 UTSW 19 26771611 critical splice donor site probably null
R1306:Smarca2 UTSW 19 26770988 missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26630828 missense probably damaging 1.00
R1400:Smarca2 UTSW 19 26676740 missense probably damaging 0.98
R1415:Smarca2 UTSW 19 26710684 missense probably null 0.72
R1496:Smarca2 UTSW 19 26631101 missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26751905 missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26640380 splice site probably benign
R1861:Smarca2 UTSW 19 26623884 missense probably benign 0.03
R1962:Smarca2 UTSW 19 26672724 nonsense probably null
R1964:Smarca2 UTSW 19 26672724 nonsense probably null
R1998:Smarca2 UTSW 19 26631093 missense probably benign 0.33
R2014:Smarca2 UTSW 19 26683905 missense possibly damaging 0.86
R2255:Smarca2 UTSW 19 26771038 missense probably benign 0.01
R2392:Smarca2 UTSW 19 26640650 critical splice donor site probably null
R2439:Smarca2 UTSW 19 26691454 critical splice donor site probably null
R3030:Smarca2 UTSW 19 26752029 missense possibly damaging 0.84
R3195:Smarca2 UTSW 19 26683822 missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26668890 unclassified probably benign
R3845:Smarca2 UTSW 19 26720873 missense probably benign 0.06
R4013:Smarca2 UTSW 19 26683927 splice site probably null
R4014:Smarca2 UTSW 19 26683927 splice site probably null
R4016:Smarca2 UTSW 19 26683927 splice site probably null
R4271:Smarca2 UTSW 19 26720949 critical splice donor site probably null
R4471:Smarca2 UTSW 19 26619877 missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26776225 missense possibly damaging 0.70
R4730:Smarca2 UTSW 19 26630673 missense probably damaging 1.00
R4755:Smarca2 UTSW 19 26654483 missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26720855 nonsense probably null
R5015:Smarca2 UTSW 19 26691388 missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26691372 missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26640429 missense probably benign 0.18
R5503:Smarca2 UTSW 19 26623936 missense probably damaging 0.96
R5503:Smarca2 UTSW 19 26682046 missense possibly damaging 0.93
R5715:Smarca2 UTSW 19 26649122 missense probably benign 0.16
R5790:Smarca2 UTSW 19 26676724 missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26776069 intron probably benign
R6209:Smarca2 UTSW 19 26771004 nonsense probably null
R6236:Smarca2 UTSW 19 26696213 missense probably benign 0.33
R6291:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26678363 missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26630931 missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26679173 missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26619884 missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26654377 missense probably benign 0.30
R6804:Smarca2 UTSW 19 26751886 missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26669155 missense possibly damaging 0.83
R7213:Smarca2 UTSW 19 26647131 missense possibly damaging 0.96
R7257:Smarca2 UTSW 19 26654464 nonsense probably null
R7259:Smarca2 UTSW 19 26654464 nonsense probably null
R7479:Smarca2 UTSW 19 26640487 missense probably benign 0.00
R7512:Smarca2 UTSW 19 26683809 missense possibly damaging 0.51
R8158:Smarca2 UTSW 19 26682048 missense probably benign 0.16
R8182:Smarca2 UTSW 19 26630720 missense probably benign 0.39
R8207:Smarca2 UTSW 19 26676680 missense possibly damaging 0.71
R8467:Smarca2 UTSW 19 26619721 start codon destroyed probably null 0.02
R8527:Smarca2 UTSW 19 26676787 missense probably damaging 0.98
R8784:Smarca2 UTSW 19 26776158 missense probably benign 0.17
R8898:Smarca2 UTSW 19 26630958 unclassified probably benign
R9076:Smarca2 UTSW 19 26682052 missense possibly damaging 0.52
R9123:Smarca2 UTSW 19 26716183 missense possibly damaging 0.84
R9125:Smarca2 UTSW 19 26716183 missense possibly damaging 0.84
R9501:Smarca2 UTSW 19 26640577 missense probably benign 0.04
R9514:Smarca2 UTSW 19 26682052 missense possibly damaging 0.71
R9641:Smarca2 UTSW 19 26679098 missense possibly damaging 0.93
RF001:Smarca2 UTSW 19 26630986 unclassified probably benign
RF001:Smarca2 UTSW 19 26631021 unclassified probably benign
RF004:Smarca2 UTSW 19 26631020 unclassified probably benign
RF019:Smarca2 UTSW 19 26631001 unclassified probably benign
RF021:Smarca2 UTSW 19 26630997 unclassified probably benign
RF024:Smarca2 UTSW 19 26631020 unclassified probably benign
RF034:Smarca2 UTSW 19 26631011 unclassified probably benign
RF040:Smarca2 UTSW 19 26631022 unclassified probably benign
RF041:Smarca2 UTSW 19 26631021 unclassified probably benign
RF047:Smarca2 UTSW 19 26631005 unclassified probably benign
RF051:Smarca2 UTSW 19 26630988 unclassified probably benign
X0061:Smarca2 UTSW 19 26720840 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCACTGCTTCTAGAACCACG -3'
(R):5'- TTCCCAGTAGAGGTGACTGG -3'

Sequencing Primer
(F):5'- ACTGCAGGAAGGGCTCAG -3'
(R):5'- GCTCTGTGTACCAAAGGA -3'
Posted On 2022-03-25