Mutagenetix > Incidental Mutation

Incidental Mutation 'R9317:Smarca2'

705934

Institutional Source

Beutler Lab

Gene Symbol

Smarca2

Ensembl Gene

ENSMUSG00000024921

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

Synonyms

Snf2l2, brm, 2610209L14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9317 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26582578-26755721 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26737279 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 65 (C65R)

Ref Sequence

ENSEMBL: ENSMUSP00000135412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000112637] [ENSMUST00000175791] [ENSMUST00000175842] [ENSMUST00000175953] [ENSMUST00000176030] [ENSMUST00000176475] [ENSMUST00000176698] [ENSMUST00000176731] [ENSMUST00000176769] [ENSMUST00000177252] [ENSMUST00000207054] [ENSMUST00000207118] [ENSMUST00000207812] [ENSMUST00000207832] [ENSMUST00000208027] [ENSMUST00000208091] [ENSMUST00000208186] [ENSMUST00000208226] [ENSMUST00000208541] [ENSMUST00000208589] [ENSMUST00000208705] [ENSMUST00000208712] [ENSMUST00000208751] [ENSMUST00000208915] [ENSMUST00000209085]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000025862

SMART Domains

Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1501	3.13e-41	SMART
low complexity region	1502	1524	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1564	1576	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099537
AA Change: C1412R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: C1412R

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	7e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
PDB:2DAT\|A	1389	1410	1e-6	PDB
low complexity region	1480	1508	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112637

SMART Domains

Protein: ENSMUSP00000108256
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
BROMO	44	154	3.13e-41	SMART
low complexity region	155	177	N/A	INTRINSIC
low complexity region	179	193	N/A	INTRINSIC
low complexity region	217	229	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000175791
AA Change: C65R

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000135412
Gene: ENSMUSG00000024921
AA Change: C65R

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
BROMO	44	172	1.74e-39	SMART
low complexity region	173	195	N/A	INTRINSIC
low complexity region	197	211	N/A	INTRINSIC
low complexity region	235	247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175842

SMART Domains

Protein: ENSMUSP00000135800
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	37	59	N/A	INTRINSIC
BROMO	84	212	1.74e-39	SMART
low complexity region	213	235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175953

SMART Domains

Protein: ENSMUSP00000135042
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
SCOP:d1jb0a_	16	80	5e-3	SMART
PDB:2DAT\|A	42	83	3e-23	PDB
Blast:BROMO	44	83	3e-21	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176030
AA Change: C1412R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: C1412R

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1519	1.74e-39	SMART
low complexity region	1520	1542	N/A	INTRINSIC
low complexity region	1544	1558	N/A	INTRINSIC
low complexity region	1582	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176475

SMART Domains

Protein: ENSMUSP00000135248
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	37	59	N/A	INTRINSIC
BROMO	84	194	3.13e-41	SMART
low complexity region	195	217	N/A	INTRINSIC
low complexity region	219	233	N/A	INTRINSIC
low complexity region	257	269	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176698
AA Change: C65R

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134914
Gene: ENSMUSG00000024921
AA Change: C65R

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
BROMO	44	172	1.74e-39	SMART
low complexity region	173	195	N/A	INTRINSIC
low complexity region	197	211	N/A	INTRINSIC
low complexity region	235	247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176731

SMART Domains

Protein: ENSMUSP00000135460
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
PDB:2DAT\|A	10	33	8e-9	PDB
Blast:BROMO	12	35	6e-7	BLAST
low complexity region	83	111	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176769

SMART Domains

Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	908	4.18e-24	SMART
low complexity region	947	956	N/A	INTRINSIC
HELICc	1033	1117	3.84e-23	SMART
low complexity region	1175	1190	N/A	INTRINSIC
SnAC	1211	1279	7.29e-28	SMART
low complexity region	1286	1308	N/A	INTRINSIC
BROMO	1333	1443	3.13e-41	SMART
low complexity region	1444	1466	N/A	INTRINSIC
low complexity region	1468	1482	N/A	INTRINSIC
low complexity region	1506	1518	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177252

SMART Domains

Protein: ENSMUSP00000134995
Gene: ENSMUSG00000024921

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
BROMO	44	154	3.13e-41	SMART
low complexity region	155	177	N/A	INTRINSIC
low complexity region	179	193	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207054

Predicted Effect

probably benign
Transcript: ENSMUST00000207118

Predicted Effect

possibly damaging
Transcript: ENSMUST00000207535
AA Change: C36R

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000207812

Predicted Effect

probably benign
Transcript: ENSMUST00000207832

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208027
AA Change: C105R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000208091

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208186
AA Change: C105R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000208226

Predicted Effect

probably benign
Transcript: ENSMUST00000208541

Predicted Effect

probably benign
Transcript: ENSMUST00000208589

Predicted Effect

probably benign
Transcript: ENSMUST00000208674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208705
AA Change: C65R

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000208712

Predicted Effect

probably benign
Transcript: ENSMUST00000208751

Predicted Effect

probably benign
Transcript: ENSMUST00000208915

Predicted Effect

probably benign
Transcript: ENSMUST00000209085

Meta Mutation Damage Score

0.1280

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adad2	T	C	8: 120,342,180 (GRCm39)	L307P	probably damaging	Het
Apcdd1	C	T	18: 63,055,731 (GRCm39)		probably benign	Het
C1qbp	T	C	11: 70,868,929 (GRCm39)	N278D	probably benign	Het
Cd68	C	T	11: 69,555,860 (GRCm39)		probably null	Het
Cdc37l1	T	G	19: 28,972,518 (GRCm39)	N70K	probably damaging	Het
Cyp3a57	T	C	5: 145,309,421 (GRCm39)	V253A	possibly damaging	Het
Dnmt1	A	G	9: 20,829,575 (GRCm39)	F795S	probably damaging	Het
Gli3	T	A	13: 15,889,658 (GRCm39)	S591T	probably damaging	Het
Gmeb1	A	T	4: 131,953,349 (GRCm39)	S472R	probably benign	Het
Gpr158	T	C	2: 21,832,037 (GRCm39)	S1046P	probably benign	Het
Grik5	A	G	7: 24,745,660 (GRCm39)	L471P	probably damaging	Het
Hmcn2	G	A	2: 31,350,328 (GRCm39)	R5075H	possibly damaging	Het
Hspa5	G	T	2: 34,666,070 (GRCm39)	S638I	probably benign	Het
Ilf3	A	G	9: 21,307,422 (GRCm39)	Y355C	probably damaging	Het
Kalrn	T	C	16: 33,834,045 (GRCm39)	T2366A		Het
Negr1	T	A	3: 156,904,081 (GRCm39)	C315S	probably benign	Het
Or2n1d	A	T	17: 38,646,320 (GRCm39)	T91S	possibly damaging	Het
Or8b52	T	A	9: 38,576,655 (GRCm39)	M162L	probably benign	Het
Prr5	C	T	15: 84,583,324 (GRCm39)	Q110*	probably null	Het
Prune2	T	A	19: 17,099,034 (GRCm39)	S1513T	probably benign	Het
Ptprk	A	G	10: 28,230,731 (GRCm39)	E274G	probably damaging	Het
Qrfprl	A	C	6: 65,424,368 (GRCm39)	I174L	probably benign	Het
Rmdn3	G	A	2: 118,986,991 (GRCm39)	A12V	unknown	Het
Rpf1	A	G	3: 146,218,016 (GRCm39)	V166A	probably benign	Het
Senp5	A	C	16: 31,802,390 (GRCm39)	F554C	probably damaging	Het
Sprr2j-ps	T	A	3: 92,326,178 (GRCm39)	C18S	unknown	Het
Sult2a6	A	T	7: 13,970,615 (GRCm39)	Y160*	probably null	Het
Taar8a	T	C	10: 23,952,753 (GRCm39)	V119A	probably benign	Het
Tmtc3	T	C	10: 100,301,896 (GRCm39)	K351R	probably benign	Het
Trpc1	A	G	9: 95,603,275 (GRCm39)	L419P	probably damaging	Het
Ttn	T	C	2: 76,641,699 (GRCm39)	K13466E	possibly damaging	Het
Unc13c	A	G	9: 73,447,662 (GRCm39)	F1846S	possibly damaging	Het
Usp48	G	A	4: 137,340,996 (GRCm39)	G332E	probably benign	Het
Vmn2r72	A	T	7: 85,404,022 (GRCm39)	N56K	probably benign	Het
Wdr12	C	A	1: 60,128,455 (GRCm39)	M98I	probably benign	Het
Zfp953	T	C	13: 67,491,457 (GRCm39)	Y165C	possibly damaging	Het

Other mutations in Smarca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01368:Smarca2	APN	19	26,751,694 (GRCm39)	missense	possibly damaging	0.82
IGL01907:Smarca2	APN	19	26,675,865 (GRCm39)	missense	possibly damaging	0.59
IGL02039:Smarca2	APN	19	26,693,537 (GRCm39)	missense	probably damaging	1.00
IGL02110:Smarca2	APN	19	26,650,140 (GRCm39)	missense	possibly damaging	0.96
IGL02561:Smarca2	APN	19	26,693,582 (GRCm39)	missense	possibly damaging	0.92
IGL02649:Smarca2	APN	19	26,617,986 (GRCm39)	missense	possibly damaging	0.73
IGL02880:Smarca2	APN	19	26,654,024 (GRCm39)	splice site	probably benign
IGL03028:Smarca2	APN	19	26,655,712 (GRCm39)	splice site	probably benign
IGL03187:Smarca2	APN	19	26,650,224 (GRCm39)	missense	probably damaging	0.98
IGL03213:Smarca2	APN	19	26,601,375 (GRCm39)	missense	probably damaging	1.00
IGL03354:Smarca2	APN	19	26,597,303 (GRCm39)	missense	probably benign	0.01
Genghis	UTSW	19	26,597,284 (GRCm39)	missense	possibly damaging	0.53
kraft	UTSW	19	26,655,763 (GRCm39)	missense	probably damaging	0.99
Kublai	UTSW	19	26,618,013 (GRCm39)	missense	probably damaging	1.00
Samarkand	UTSW	19	26,631,864 (GRCm39)	nonsense	probably null
tashkent	UTSW	19	26,698,273 (GRCm39)	missense	probably benign	0.06
Xanadu	UTSW	19	26,659,452 (GRCm39)	missense	possibly damaging	0.52
FR4737:Smarca2	UTSW	19	26,608,399 (GRCm39)	unclassified	probably benign
PIT1430001:Smarca2	UTSW	19	26,626,493 (GRCm39)	missense	probably benign	0.35
R0184:Smarca2	UTSW	19	26,669,649 (GRCm39)	nonsense	probably null
R0306:Smarca2	UTSW	19	26,618,013 (GRCm39)	missense	probably damaging	1.00
R0538:Smarca2	UTSW	19	26,668,762 (GRCm39)	missense	probably damaging	0.99
R0565:Smarca2	UTSW	19	26,659,275 (GRCm39)	missense	possibly damaging	0.71
R0610:Smarca2	UTSW	19	26,668,791 (GRCm39)	missense	probably damaging	1.00
R0669:Smarca2	UTSW	19	26,683,600 (GRCm39)	missense	possibly damaging	0.51
R0726:Smarca2	UTSW	19	26,675,803 (GRCm39)	missense	probably damaging	1.00
R1184:Smarca2	UTSW	19	26,748,333 (GRCm39)	splice site	probably benign
R1256:Smarca2	UTSW	19	26,659,373 (GRCm39)	missense	probably benign	0.06
R1299:Smarca2	UTSW	19	26,749,011 (GRCm39)	critical splice donor site	probably null
R1306:Smarca2	UTSW	19	26,748,388 (GRCm39)	missense	possibly damaging	0.81
R1381:Smarca2	UTSW	19	26,608,228 (GRCm39)	missense	probably damaging	1.00
R1400:Smarca2	UTSW	19	26,654,140 (GRCm39)	missense	probably damaging	0.98
R1415:Smarca2	UTSW	19	26,688,084 (GRCm39)	missense	probably null	0.72
R1496:Smarca2	UTSW	19	26,608,501 (GRCm39)	missense	possibly damaging	0.85
R1582:Smarca2	UTSW	19	26,729,305 (GRCm39)	missense	probably damaging	0.99
R1666:Smarca2	UTSW	19	26,624,434 (GRCm39)	missense	possibly damaging	0.65
R1668:Smarca2	UTSW	19	26,624,434 (GRCm39)	missense	possibly damaging	0.65
R1751:Smarca2	UTSW	19	26,617,780 (GRCm39)	splice site	probably benign
R1861:Smarca2	UTSW	19	26,601,284 (GRCm39)	missense	probably benign	0.03
R1962:Smarca2	UTSW	19	26,650,124 (GRCm39)	nonsense	probably null
R1964:Smarca2	UTSW	19	26,650,124 (GRCm39)	nonsense	probably null
R1998:Smarca2	UTSW	19	26,608,493 (GRCm39)	missense	probably benign	0.33
R2014:Smarca2	UTSW	19	26,661,305 (GRCm39)	missense	possibly damaging	0.86
R2255:Smarca2	UTSW	19	26,748,438 (GRCm39)	missense	probably benign	0.01
R2392:Smarca2	UTSW	19	26,618,050 (GRCm39)	critical splice donor site	probably null
R2439:Smarca2	UTSW	19	26,668,854 (GRCm39)	critical splice donor site	probably null
R3030:Smarca2	UTSW	19	26,729,429 (GRCm39)	missense	possibly damaging	0.84
R3195:Smarca2	UTSW	19	26,661,222 (GRCm39)	missense	possibly damaging	0.85
R3430:Smarca2	UTSW	19	26,668,749 (GRCm39)	missense	probably damaging	1.00
R3710:Smarca2	UTSW	19	26,646,290 (GRCm39)	unclassified	probably benign
R3845:Smarca2	UTSW	19	26,698,273 (GRCm39)	missense	probably benign	0.06
R4013:Smarca2	UTSW	19	26,661,327 (GRCm39)	splice site	probably null
R4014:Smarca2	UTSW	19	26,661,327 (GRCm39)	splice site	probably null
R4016:Smarca2	UTSW	19	26,661,327 (GRCm39)	splice site	probably null
R4271:Smarca2	UTSW	19	26,698,349 (GRCm39)	critical splice donor site	probably null
R4471:Smarca2	UTSW	19	26,597,277 (GRCm39)	missense	possibly damaging	0.86
R4612:Smarca2	UTSW	19	26,753,625 (GRCm39)	missense	possibly damaging	0.70
R4730:Smarca2	UTSW	19	26,608,073 (GRCm39)	missense	probably damaging	1.00
R4755:Smarca2	UTSW	19	26,631,883 (GRCm39)	missense	possibly damaging	0.86
R4999:Smarca2	UTSW	19	26,698,255 (GRCm39)	nonsense	probably null
R5015:Smarca2	UTSW	19	26,668,788 (GRCm39)	missense	possibly damaging	0.86
R5320:Smarca2	UTSW	19	26,668,772 (GRCm39)	missense	probably damaging	1.00
R5393:Smarca2	UTSW	19	26,617,829 (GRCm39)	missense	probably benign	0.18
R5503:Smarca2	UTSW	19	26,659,446 (GRCm39)	missense	possibly damaging	0.93
R5503:Smarca2	UTSW	19	26,601,336 (GRCm39)	missense	probably damaging	0.96
R5715:Smarca2	UTSW	19	26,626,522 (GRCm39)	missense	probably benign	0.16
R5790:Smarca2	UTSW	19	26,654,124 (GRCm39)	missense	probably damaging	1.00
R5874:Smarca2	UTSW	19	26,753,469 (GRCm39)	intron	probably benign
R6209:Smarca2	UTSW	19	26,748,404 (GRCm39)	nonsense	probably null
R6236:Smarca2	UTSW	19	26,673,613 (GRCm39)	missense	probably benign	0.33
R6291:Smarca2	UTSW	19	26,608,292 (GRCm39)	missense	probably damaging	1.00
R6292:Smarca2	UTSW	19	26,608,292 (GRCm39)	missense	probably damaging	1.00
R6325:Smarca2	UTSW	19	26,655,763 (GRCm39)	missense	probably damaging	0.99
R6544:Smarca2	UTSW	19	26,608,331 (GRCm39)	missense	probably damaging	1.00
R6572:Smarca2	UTSW	19	26,656,573 (GRCm39)	missense	possibly damaging	0.71
R6589:Smarca2	UTSW	19	26,597,284 (GRCm39)	missense	possibly damaging	0.53
R6601:Smarca2	UTSW	19	26,631,777 (GRCm39)	missense	probably benign	0.30
R6804:Smarca2	UTSW	19	26,729,286 (GRCm39)	missense	possibly damaging	0.93
R6922:Smarca2	UTSW	19	26,668,749 (GRCm39)	missense	probably damaging	1.00
R7047:Smarca2	UTSW	19	26,646,555 (GRCm39)	missense	possibly damaging	0.83
R7213:Smarca2	UTSW	19	26,624,531 (GRCm39)	missense	possibly damaging	0.96
R7257:Smarca2	UTSW	19	26,631,864 (GRCm39)	nonsense	probably null
R7259:Smarca2	UTSW	19	26,631,864 (GRCm39)	nonsense	probably null
R7479:Smarca2	UTSW	19	26,617,887 (GRCm39)	missense	probably benign	0.00
R7512:Smarca2	UTSW	19	26,661,209 (GRCm39)	missense	possibly damaging	0.51
R8158:Smarca2	UTSW	19	26,659,448 (GRCm39)	missense	probably benign	0.16
R8182:Smarca2	UTSW	19	26,608,120 (GRCm39)	missense	probably benign	0.39
R8207:Smarca2	UTSW	19	26,654,080 (GRCm39)	missense	possibly damaging	0.71
R8467:Smarca2	UTSW	19	26,597,121 (GRCm39)	start codon destroyed	probably null	0.02
R8527:Smarca2	UTSW	19	26,654,187 (GRCm39)	missense	probably damaging	0.98
R8784:Smarca2	UTSW	19	26,753,558 (GRCm39)	missense	probably benign	0.17
R8898:Smarca2	UTSW	19	26,608,358 (GRCm39)	unclassified	probably benign
R9076:Smarca2	UTSW	19	26,659,452 (GRCm39)	missense	possibly damaging	0.52
R9123:Smarca2	UTSW	19	26,693,583 (GRCm39)	missense	possibly damaging	0.84
R9125:Smarca2	UTSW	19	26,693,583 (GRCm39)	missense	possibly damaging	0.84
R9501:Smarca2	UTSW	19	26,617,977 (GRCm39)	missense	probably benign	0.04
R9514:Smarca2	UTSW	19	26,659,452 (GRCm39)	missense	possibly damaging	0.71
R9641:Smarca2	UTSW	19	26,656,498 (GRCm39)	missense	possibly damaging	0.93
RF001:Smarca2	UTSW	19	26,608,421 (GRCm39)	unclassified	probably benign
RF001:Smarca2	UTSW	19	26,608,386 (GRCm39)	unclassified	probably benign
RF004:Smarca2	UTSW	19	26,608,420 (GRCm39)	unclassified	probably benign
RF019:Smarca2	UTSW	19	26,608,401 (GRCm39)	unclassified	probably benign
RF021:Smarca2	UTSW	19	26,608,397 (GRCm39)	unclassified	probably benign
RF024:Smarca2	UTSW	19	26,608,420 (GRCm39)	unclassified	probably benign
RF034:Smarca2	UTSW	19	26,608,411 (GRCm39)	unclassified	probably benign
RF040:Smarca2	UTSW	19	26,608,422 (GRCm39)	unclassified	probably benign
RF041:Smarca2	UTSW	19	26,608,421 (GRCm39)	unclassified	probably benign
RF047:Smarca2	UTSW	19	26,608,405 (GRCm39)	unclassified	probably benign
RF051:Smarca2	UTSW	19	26,608,388 (GRCm39)	unclassified	probably benign
X0061:Smarca2	UTSW	19	26,698,240 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCACTGCTTCTAGAACCACG -3'
(R):5'- TTCCCAGTAGAGGTGACTGG -3'

Sequencing Primer
(F):5'- ACTGCAGGAAGGGCTCAG -3'
(R):5'- GCTCTGTGTACCAAAGGA -3'

Posted On

2022-03-25