Incidental Mutation 'R0743:Gosr1'
List |< first << previous [record 13 of 58] next >> last >|
ID70795
Institutional Source Beutler Lab
Gene Symbol Gosr1
Ensembl Gene ENSMUSG00000010392
Gene Namegolgi SNAP receptor complex member 1
SynonymsGOS-28, Cis-Golgi SNARE, GS28
MMRRC Submission 038924-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R0743 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location76726602-76763579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76730146 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 239 (I239T)
Ref Sequence ENSEMBL: ENSMUSP00000010536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010536]
Predicted Effect probably benign
Transcript: ENSMUST00000010536
AA Change: I239T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010536
Gene: ENSMUSG00000010392
AA Change: I239T

DomainStartEndE-ValueType
Pfam:V-SNARE_C 161 226 1.9e-25 PFAM
transmembrane domain 230 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Csmd2 A T 4: 128,113,676 T149S probably benign Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Dnm2 T A 9: 21,500,265 Y597N probably damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Glrb T A 3: 80,879,680 I59F probably damaging Het
Gm13089 A T 4: 143,698,564 I103N probably damaging Het
Gm17689 T C 9: 36,581,301 S103G probably benign Het
Kif5b G T 18: 6,209,192 R857S probably damaging Het
Kmt5a C A 5: 124,447,219 N44K probably damaging Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Maats1 A G 16: 38,335,634 F76L possibly damaging Het
Mep1b A G 18: 21,080,458 D68G possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfat5 G A 8: 107,368,066 E962K probably damaging Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Npepps A G 11: 97,206,058 probably benign Het
Nphp3 GCATCATCATCATCATC GCATCATCATCATC 9: 104,022,768 probably benign Het
Olfr1100 G A 2: 86,978,499 T99I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Olfr798 T A 10: 129,625,843 T73S probably benign Het
Ovgp1 T A 3: 105,974,932 L37H probably damaging Het
Padi3 G T 4: 140,786,429 A646D probably benign Het
Pamr1 A G 2: 102,609,907 E142G probably damaging Het
Papolg A T 11: 23,870,818 probably null Het
Pfkl C T 10: 77,995,243 probably null Het
Plrg1 T C 3: 83,059,917 S132P probably benign Het
Prr14l C A 5: 32,831,194 C319F possibly damaging Het
Prtn3 T A 10: 79,879,677 M1K probably null Het
Ptpn22 T C 3: 103,902,171 F700S probably damaging Het
Ptprz1 C T 6: 23,044,367 Q1273* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Sec16a G A 2: 26,419,722 L2091F possibly damaging Het
Senp6 C T 9: 80,093,589 R27C probably damaging Het
Shcbp1 T A 8: 4,764,906 M191L probably benign Het
Sirt4 T C 5: 115,482,955 K53E probably benign Het
Slc10a2 A G 8: 5,089,132 S271P probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc38a10 C T 11: 120,140,643 V103M probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Stab2 T A 10: 86,887,895 I1479F probably damaging Het
Synpo2 A G 3: 123,112,706 V987A probably benign Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tmem39a A T 16: 38,585,402 I200F probably damaging Het
Ttn G A 2: 76,749,269 T23760M probably damaging Het
Uqcrc1 C T 9: 108,944,705 Q22* probably null Het
Wdtc1 A G 4: 133,300,661 W377R probably damaging Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Other mutations in Gosr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Gosr1 APN 11 76754756 missense probably benign 0.34
IGL02640:Gosr1 APN 11 76754777 missense probably benign 0.01
IGL02686:Gosr1 APN 11 76750862 missense probably benign 0.00
IGL02939:Gosr1 APN 11 76750906 splice site probably benign
IGL03325:Gosr1 APN 11 76754403 missense probably benign 0.04
R0884:Gosr1 UTSW 11 76730146 missense probably benign
R1712:Gosr1 UTSW 11 76750878 missense possibly damaging 0.58
R2064:Gosr1 UTSW 11 76737398 missense probably benign 0.00
R4403:Gosr1 UTSW 11 76754735 missense possibly damaging 0.77
R4919:Gosr1 UTSW 11 76734566 splice site probably null
R7342:Gosr1 UTSW 11 76730207 missense probably benign 0.00
R7507:Gosr1 UTSW 11 76754414 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGCCACAGGTGCAGTTTGGAATC -3'
(R):5'- GCGTTTATCCCAGATGGGAATGCAG -3'

Sequencing Primer
(F):5'- CAGTTTGGAATCCATCTGCTGG -3'
(R):5'- GAATGCAGGTTGCTCCTTTC -3'
Posted On2013-09-30