Incidental Mutation 'R9525:Fgd2'
ID 719183
Institutional Source Beutler Lab
Gene Symbol Fgd2
Ensembl Gene ENSMUSG00000024013
Gene Name FYVE, RhoGEF and PH domain containing 2
Synonyms Tcd-2, tcs2, Tcd2, tcs-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock # R9525 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 29360914-29379660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29364981 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 123 (L123Q)
Ref Sequence ENSEMBL: ENSMUSP00000024810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024810] [ENSMUST00000123989]
AlphaFold Q8BY35
Predicted Effect probably damaging
Transcript: ENSMUST00000024810
AA Change: L123Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024810
Gene: ENSMUSG00000024013
AA Change: L123Q

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
PH 320 420 2.09e-16 SMART
FYVE 450 519 1.07e-28 SMART
PH 545 643 5.09e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123989
AA Change: L123Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118828
Gene: ENSMUSG00000024013
AA Change: L123Q

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of guanine nucleotide exchange factors (GEFs) which control cytoskeleton-dependent membrane rearrangements by activating the cell division cycle 42 (CDC42) protein. This gene is expressed in B lymphocytes, macrophages, and dendritic cells. The encoded protein may play a role in leukocyte signaling and vesicle trafficking in antigen-presenting cells in the immune system. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik A T 5: 109,676,980 N201K Het
Adgrv1 C T 13: 81,445,334 G4178E possibly damaging Het
Alpk2 A G 18: 65,266,217 Y2097H probably damaging Het
Anapc2 T C 2: 25,276,327 S369P probably damaging Het
Atr C T 9: 95,910,557 A1644V possibly damaging Het
Camsap1 G A 2: 25,953,950 H230Y probably benign Het
Cbx7 A C 15: 79,930,596 W35G probably damaging Het
Cc2d2b T C 19: 40,784,986 Y498H probably damaging Het
Ccdc162 T A 10: 41,683,226 R126W probably damaging Het
Cd274 T A 19: 29,382,479 L228Q probably benign Het
Cfap57 A T 4: 118,576,581 I1000N probably damaging Het
Chadl C A 15: 81,694,019 G470C probably damaging Het
Clasp2 T C 9: 113,911,609 L1217P probably damaging Het
Crnkl1 A G 2: 145,928,278 V215A probably benign Het
Dbx2 G T 15: 95,654,423 H114N probably benign Het
Ddb2 T G 2: 91,234,835 T82P probably benign Het
Emc8 T C 8: 120,667,917 Y21C probably damaging Het
Epha1 A T 6: 42,367,824 M66K probably damaging Het
Fan1 A C 7: 64,372,259 probably null Het
Flnb T A 14: 7,905,481 V1077E probably damaging Het
Fnbp1l A T 3: 122,559,054 M251K probably damaging Het
Gal3st2c T A 1: 94,008,206 F93L probably damaging Het
Gdf2 T C 14: 33,945,607 *429Q probably null Het
Gdpd5 A G 7: 99,454,949 T455A possibly damaging Het
Gm11238 G A 4: 73,654,824 S100N probably benign Het
Gm13124 T A 4: 144,555,430 D264V possibly damaging Het
Gm4788 G T 1: 139,774,512 T78K probably damaging Het
Gm8356 G T 14: 6,535,192 Q109K Het
Gpr20 A T 15: 73,695,832 V236E probably benign Het
Gpr39 T C 1: 125,872,586 V358A probably damaging Het
Grin1 T C 2: 25,297,460 N613D probably damaging Het
Hepacam2 A G 6: 3,476,046 V293A probably benign Het
Hist1h2bn G T 13: 21,754,135 A5S unknown Het
Igf1r G A 7: 68,214,934 R1160Q probably damaging Het
Iqcd T C 5: 120,600,152 Y12H probably benign Het
Itih1 T C 14: 30,936,754 S393G probably benign Het
Klhl33 T C 14: 50,891,472 M507V probably null Het
Mast4 G T 13: 102,736,436 H2141Q probably benign Het
Mkrn2 T A 6: 115,610,525 D54E probably damaging Het
Mrm3 A G 11: 76,250,278 T371A possibly damaging Het
Mylk2 T A 2: 152,917,632 M414K probably damaging Het
Nlrp4b A G 7: 10,714,821 E317G probably damaging Het
Olfr1051 A G 2: 86,276,140 S116P probably benign Het
Olfr623 A T 7: 103,660,935 I105N probably damaging Het
Olfr641 A G 7: 104,040,613 I272M possibly damaging Het
Pcdhb18 T A 18: 37,491,834 V739E probably damaging Het
Pkhd1l1 A T 15: 44,584,926 T3834S possibly damaging Het
Pkp3 A G 7: 141,088,397 D546G probably damaging Het
Pot1a A T 6: 25,745,917 M595K probably benign Het
Pus7l A G 15: 94,540,883 I27T probably damaging Het
Rbp3 A G 14: 33,954,445 I117V probably benign Het
Rnf19a A T 15: 36,247,229 L454H probably damaging Het
Rps6kb1 C A 11: 86,519,920 K167N possibly damaging Het
Saxo1 A T 4: 86,444,949 Y432* probably null Het
Setdb2 A T 14: 59,409,392 V558E probably benign Het
Tbck T C 3: 132,751,205 F627L probably damaging Het
Tbpl2 T G 2: 24,096,535 M1L probably benign Het
Tcrg-V5 T C 13: 19,192,715 C111R probably damaging Het
Thegl A G 5: 77,047,291 N104S probably benign Het
Timp2 A C 11: 118,303,852 D170E probably benign Het
Tomm40 A G 7: 19,702,887 Y303H probably damaging Het
Trhr T C 15: 44,197,477 I131T possibly damaging Het
Vmn1r159 A G 7: 22,842,992 V205A probably damaging Het
Vmn2r25 G T 6: 123,823,205 T726K probably damaging Het
Wwox T A 8: 114,706,365 V257E probably benign Het
Xxylt1 A G 16: 31,050,775 I169T probably benign Het
Zfp457 T C 13: 67,293,428 Y361C probably damaging Het
Other mutations in Fgd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Fgd2 APN 17 29367975 missense probably damaging 1.00
IGL01505:Fgd2 APN 17 29366997 missense probably damaging 1.00
IGL03240:Fgd2 APN 17 29361161 splice site probably benign
ceci UTSW 17 29368376 splice site probably null
R0046:Fgd2 UTSW 17 29374990 splice site probably benign
R0271:Fgd2 UTSW 17 29367008 missense possibly damaging 0.94
R0594:Fgd2 UTSW 17 29365552 missense probably damaging 1.00
R0612:Fgd2 UTSW 17 29378347 missense probably benign 0.45
R1470:Fgd2 UTSW 17 29374108 splice site probably benign
R1551:Fgd2 UTSW 17 29378409 missense probably damaging 1.00
R1596:Fgd2 UTSW 17 29376930 missense probably benign 0.43
R1664:Fgd2 UTSW 17 29369299 missense probably damaging 1.00
R1689:Fgd2 UTSW 17 29363722 missense probably benign
R1691:Fgd2 UTSW 17 29378944 nonsense probably null
R1695:Fgd2 UTSW 17 29368245 missense possibly damaging 0.88
R2697:Fgd2 UTSW 17 29376921 missense probably damaging 1.00
R3500:Fgd2 UTSW 17 29365601 missense possibly damaging 0.74
R3689:Fgd2 UTSW 17 29378950 missense probably benign 0.00
R4583:Fgd2 UTSW 17 29367078 missense possibly damaging 0.87
R4871:Fgd2 UTSW 17 29373249 missense possibly damaging 0.89
R5011:Fgd2 UTSW 17 29374980 critical splice donor site probably null
R5209:Fgd2 UTSW 17 29368376 splice site probably null
R7106:Fgd2 UTSW 17 29376970 nonsense probably null
R7139:Fgd2 UTSW 17 29373255 missense probably damaging 1.00
R7712:Fgd2 UTSW 17 29376912 missense probably benign 0.01
R7833:Fgd2 UTSW 17 29367395 missense possibly damaging 0.81
R7834:Fgd2 UTSW 17 29364951 missense probably damaging 1.00
R7913:Fgd2 UTSW 17 29374045 missense probably damaging 1.00
R8547:Fgd2 UTSW 17 29364960 missense probably damaging 0.99
R8686:Fgd2 UTSW 17 29379023 missense probably benign
R9088:Fgd2 UTSW 17 29364939 missense probably damaging 1.00
Z1177:Fgd2 UTSW 17 29378326 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTATGAAAGCTGGTCCAGTGC -3'
(R):5'- TCAAACGAGGCTGCCATGTATG -3'

Sequencing Primer
(F):5'- AAAGCTGGTCCAGTGCCAGAC -3'
(R):5'- CATGTATGAGGCTGGCCAG -3'
Posted On 2022-07-18