Mutagenetix > Incidental Mutation

Incidental Mutation 'R9784:Stk39'

734187

Institutional Source

Beutler Lab

Gene Symbol

Stk39

Ensembl Gene

ENSMUSG00000027030

Gene Name

serine/threonine kinase 39

Synonyms

DCHT, Rnl5, RF005, SPAK

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.506) question?

Stock #

R9784 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68210445-68472268 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 68368431 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 281 (G281E)

Ref Sequence

ENSEMBL: ENSMUSP00000099776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102715]

AlphaFold

Q9Z1W9

Predicted Effect

probably damaging
Transcript: ENSMUST00000102715
AA Change: G281E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030
AA Change: G281E

Domain	Start	End	E-Value	Type
low complexity region	14	65	N/A	INTRINSIC
S_TKc	75	349	4.44e-80	SMART
Pfam:OSR1_C	463	494	1.3e-15	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.3%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	G	A	5: 113,190,661	P495L	possibly damaging	Het
4931440F15Rik	A	T	11: 29,825,253	V68E	probably damaging	Het
Acly	C	T	11: 100,498,286	A557T	probably benign	Het
Adgrl4	A	T	3: 151,509,311	T446S	probably damaging	Het
AK157302	A	G	13: 21,495,598	E98G	probably damaging	Het
Akap6	A	T	12: 53,141,070	T1756S	probably damaging	Het
Aldh1l1	A	G	6: 90,564,442	T273A	probably benign	Het
Aldh1l2	T	A	10: 83,506,750		probably null	Het
Alox12	T	C	11: 70,252,839	E201G	possibly damaging	Het
Arhgef16	A	G	4: 154,286,965	V257A	probably damaging	Het
Asxl3	C	T	18: 22,517,254	L767F	probably benign	Het
Atxn7l2	T	C	3: 108,203,249	K692R	probably null	Het
Btbd2	T	C	10: 80,648,647	D145G	probably damaging	Het
Cacna1b	A	T	2: 24,761,789	M126K	possibly damaging	Het
Cacna2d2	T	A	9: 107,527,147	C1081S	probably benign	Het
Cass4	T	C	2: 172,427,833	S612P	probably benign	Het
Cd209d	A	G	8: 3,876,337	S123P	probably damaging	Het
Cep112	T	C	11: 108,570,391	S665P	probably damaging	Het
Cnp	C	T	11: 100,576,611	R127W	probably damaging	Het
Col9a2	A	T	4: 121,041,029	D46V	unknown	Het
Cyp1a2	T	A	9: 57,680,279	N336I	probably benign	Het
Cyp2c37	A	G	19: 40,000,499	T301A	possibly damaging	Het
Dhtkd1	T	A	2: 5,930,811	E163D	probably benign	Het
Dido1	A	T	2: 180,683,561	F611L	probably benign	Het
Dnah9	T	A	11: 66,085,134	N1363I	probably damaging	Het
Drg2	A	G	11: 60,467,722	K331R	probably benign	Het
Fam171b	T	A	2: 83,860,443	I250K	probably damaging	Het
Fut8	T	A	12: 77,412,839	I242N	probably damaging	Het
Glyat	T	C	19: 12,651,480	V247A	probably benign	Het
Gucy2e	T	C	11: 69,232,690	N461S	probably benign	Het
Hif3a	T	A	7: 17,037,151	H627L	probably benign	Het
Ighv8-5	T	A	12: 115,067,608	T104S	probably benign	Het
Ighv8-9	C	T	12: 115,468,374	V106M	probably benign	Het
Inpp5f	A	C	7: 128,676,791	D435A	possibly damaging	Het
Katna1	G	C	10: 7,762,826	E440D	probably null	Het
Kmt2c	T	C	5: 25,344,961	R1341G	probably damaging	Het
Krt14	C	T	11: 100,207,140	G106S	unknown	Het
Krt39	A	G	11: 99,518,362	C238R	possibly damaging	Het
Mak	C	T	13: 41,049,360	S204N	possibly damaging	Het
Map3k5	A	G	10: 19,935,066	Y154C	probably damaging	Het
Mgam	A	G	6: 40,759,090	Y841C	probably damaging	Het
Mgst1	A	T	6: 138,147,801	R38W	probably damaging	Het
Midn	A	G	10: 80,156,413	E433G	probably damaging	Het
Muc2	T	A	7: 141,694,542	C380*	probably null	Het
Nans	G	T	4: 46,499,129	K145N	possibly damaging	Het
Nbeal1	G	A	1: 60,260,582	W1359*	probably null	Het
Neo1	T	A	9: 58,982,220	E256V	probably benign	Het
Nkd1	C	A	8: 88,591,702	D322E	probably damaging	Het
Olfm4	T	C	14: 80,011,908	V155A	probably damaging	Het
Olfr1303	A	G	2: 111,814,259	S156P	probably damaging	Het
Olfr1445	G	A	19: 12,884,510	V210M	probably benign	Het
Olfr1461	T	A	19: 13,165,449	L145Q	probably damaging	Het
Olfr409-ps1	G	T	11: 74,317,883	C286F	unknown	Het
Olfr613	T	A	7: 103,552,059	H91Q	probably benign	Het
Olfr67	T	A	7: 103,787,525	I251F	probably benign	Het
Olfr847	A	T	9: 19,375,820	D20E	probably damaging	Het
Opa1	C	A	16: 29,618,211	S646*	probably null	Het
Pcdh15	A	T	10: 74,631,380	H1743L	probably benign	Het
Ppp1r13b	T	C	12: 111,843,685	T230A	probably benign	Het
Ptf1a	G	T	2: 19,446,570	R237L	probably benign	Het
Ripk4	G	A	16: 97,748,106	P250L	possibly damaging	Het
Ropn1l	T	C	15: 31,453,503	H14R		Het
Setdb1	T	C	3: 95,325,862	S1122G	probably damaging	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc22a18	T	A	7: 143,492,941	M274K	probably benign	Het
Spink5	T	G	18: 43,986,423	F267C	probably damaging	Het
Stau1	T	C	2: 166,949,775	M481V	probably benign	Het
Stt3a	A	T	9: 36,758,783	L119Q	probably damaging	Het
Stx18	C	T	5: 38,039,291		probably benign	Het
Tgfbr3	G	T	5: 107,149,933	N200K	probably benign	Het
Timm8b	A	G	9: 50,604,973	E42G	probably benign	Het
Togaram1	T	A	12: 64,967,394	L473*	probably null	Het
Trappc12	A	G	12: 28,747,458	I25T	probably benign	Het
Trim33	T	C	3: 103,337,507	S737P	possibly damaging	Het
Trmt1	A	C	8: 84,697,701	H455P	probably damaging	Het
Trpc1	C	T	9: 95,717,593	R471H	possibly damaging	Het
Ttll2	T	A	17: 7,351,308	T407S	probably benign	Het
Unc45b	T	A	11: 82,926,160	N475K	probably damaging	Het
Usp48	T	A	4: 137,594,501	I40N	probably benign	Het
Wdr7	T	G	18: 63,904,165	V1220G	probably damaging	Het
Zfp830	C	T	11: 82,764,979	T203I	possibly damaging	Het
Zfp955a	T	A	17: 33,242,175	I328F	probably damaging	Het

Other mutations in Stk39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Stk39	APN	2	68314564	missense	possibly damaging	0.81
IGL00966:Stk39	APN	2	68211958	missense	probably benign	0.01
IGL01936:Stk39	APN	2	68314564	missense	probably benign	0.21
IGL02301:Stk39	APN	2	68211962	missense	probably damaging	1.00
IGL02940:Stk39	APN	2	68220899	splice site	probably null
claimjumper	UTSW	2	68314579	missense	probably damaging	0.96
outlaw	UTSW	2	68307039	critical splice donor site	probably null
rustler	UTSW	2	68263303	missense	probably damaging	1.00
R0570:Stk39	UTSW	2	68410048	missense	probably damaging	1.00
R0609:Stk39	UTSW	2	68366167	missense	probably damaging	1.00
R0670:Stk39	UTSW	2	68366182	missense	possibly damaging	0.93
R0980:Stk39	UTSW	2	68392171	missense	probably damaging	1.00
R1024:Stk39	UTSW	2	68410046	missense	probably damaging	1.00
R1573:Stk39	UTSW	2	68390949	missense	probably damaging	1.00
R1713:Stk39	UTSW	2	68307116	splice site	probably benign
R2223:Stk39	UTSW	2	68314579	missense	probably damaging	0.96
R3700:Stk39	UTSW	2	68392118	missense	probably damaging	1.00
R4207:Stk39	UTSW	2	68220920	missense	probably benign	0.42
R4298:Stk39	UTSW	2	68390940	missense	probably damaging	1.00
R4726:Stk39	UTSW	2	68263303	missense	probably damaging	1.00
R4975:Stk39	UTSW	2	68220992	intron	probably benign
R5057:Stk39	UTSW	2	68220948	missense	probably damaging	0.99
R5384:Stk39	UTSW	2	68410039	missense	probably damaging	1.00
R5921:Stk39	UTSW	2	68366105	missense	probably damaging	0.97
R6125:Stk39	UTSW	2	68392124	missense	probably damaging	1.00
R6251:Stk39	UTSW	2	68307039	critical splice donor site	probably null
R6332:Stk39	UTSW	2	68410043	missense	possibly damaging	0.93
R6375:Stk39	UTSW	2	68392238	missense	probably benign	0.34
R7057:Stk39	UTSW	2	68410127	missense	possibly damaging	0.88
R7064:Stk39	UTSW	2	68358812	critical splice donor site	probably null
R7691:Stk39	UTSW	2	68471639	missense	probably damaging	0.97
R7921:Stk39	UTSW	2	68307039	critical splice donor site	probably null
R8155:Stk39	UTSW	2	68267066	missense	probably damaging	1.00
R8920:Stk39	UTSW	2	68471847	missense	unknown
R9003:Stk39	UTSW	2	68392118	missense	probably damaging	0.98
R9530:Stk39	UTSW	2	68368411	missense	probably damaging	1.00
R9682:Stk39	UTSW	2	68366105	missense	probably damaging	0.97
Z1176:Stk39	UTSW	2	68392198	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCAACTCAGCACTAGAGAAC -3'
(R):5'- GCCACACTGACATTTTATAAACAGC -3'

Sequencing Primer
(F):5'- ACGTGAGTCAGCCTTCAACTTG -3'
(R):5'- CTTTGGCTATCTGACACAGTAGTAG -3'

Posted On

2022-11-14