Mutagenetix > Incidental Mutation

Incidental Mutation 'R6332:Stk39'

513154

Institutional Source

Beutler Lab

Gene Symbol

Stk39

Ensembl Gene

ENSMUSG00000027030

Gene Name

serine/threonine kinase 39

Synonyms

DCHT, Rnl5, RF005, SPAK

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.468) question?

Stock #

R6332 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68210445-68472268 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68410043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 115 (M115V)

Ref Sequence

ENSEMBL: ENSMUSP00000099776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102715]

AlphaFold

Q9Z1W9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102715
AA Change: M115V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030
AA Change: M115V

Domain	Start	End	E-Value	Type
low complexity region	14	65	N/A	INTRINSIC
S_TKc	75	349	4.44e-80	SMART
Pfam:OSR1_C	463	494	1.3e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123781

Meta Mutation Damage Score

0.1103

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933421I07Rik	C	A	7: 42,446,243	G194C	possibly damaging	Het
Adamtsl1	A	G	4: 86,217,011	K258E	probably damaging	Het
Afdn	A	T	17: 13,810,445	D206V	possibly damaging	Het
Agt	G	T	8: 124,557,833	Q389K	possibly damaging	Het
Ankrd44	A	T	1: 54,762,273	D298E	probably damaging	Het
Anks1	A	G	17: 28,052,735	S897G	probably benign	Het
Apol9b	A	G	15: 77,735,546		probably null	Het
Baz1a	T	C	12: 54,918,554	E705G	probably benign	Het
BC048679	C	T	7: 81,495,218	V126M	probably benign	Het
Cep295	A	G	9: 15,334,914	F749L	possibly damaging	Het
Cntrl	T	A	2: 35,128,024	I482K	possibly damaging	Het
Col6a3	A	G	1: 90,822,233	F293S	probably damaging	Het
Dnah12	T	G	14: 26,717,974	M527R	probably damaging	Het
Dnhd1	G	A	7: 105,694,066	R1539H	probably benign	Het
Ece1	A	G	4: 137,958,008	Y603C	probably damaging	Het
Eea1	G	A	10: 96,041,473	A1350T	possibly damaging	Het
Exoc3l4	A	T	12: 111,427,968	K507N	possibly damaging	Het
Fam126b	T	A	1: 58,529,875	Y515F	probably damaging	Het
Fam35a	A	G	14: 34,268,172	V259A	probably benign	Het
Flt3l	A	T	7: 45,133,667		probably null	Het
Fn1	T	C	1: 71,628,071	Q834R	probably benign	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Ifih1	T	C	2: 62,639,483	N157D	possibly damaging	Het
Itga2	A	C	13: 114,843,473	M1064R	probably benign	Het
Itgae	A	G	11: 73,111,402		probably null	Het
Krtap10-4	T	C	10: 77,827,049		probably benign	Het
Lamp3	A	G	16: 19,699,681	C269R	probably damaging	Het
Lrp5	T	C	19: 3,659,355	D125G	probably damaging	Het
Matn2	A	C	15: 34,423,755	E586D	probably benign	Het
Mef2b	T	A	8: 70,164,139		probably null	Het
Mrps22	A	G	9: 98,601,471		probably null	Het
Mtmr2	T	C	9: 13,800,029	F445L	probably damaging	Het
Nxph4	A	G	10: 127,526,368	V218A	probably damaging	Het
Olfr1308	C	T	2: 111,960,746	G109D	probably damaging	Het
Olfr382	A	G	11: 73,517,175	V8A	probably benign	Het
Olfr639	A	G	7: 104,011,773	S310P	probably benign	Het
Pdpk1	A	T	17: 24,106,922	V100D	probably damaging	Het
Phldb2	A	C	16: 45,774,246	S899A	probably benign	Het
Pnpla3	G	A	15: 84,172,782		probably null	Het
Rasal2	A	G	1: 157,299,187	Y94H	probably damaging	Het
Rlf	A	T	4: 121,148,822	I987N	possibly damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rprd2	A	G	3: 95,780,441	Y300H	probably damaging	Het
Setbp1	G	A	18: 78,783,369	S1343L	probably benign	Het
Sfswap	A	G	5: 129,571,041	K938E	possibly damaging	Het
Slc3a1	A	C	17: 85,028,432	M1L	probably damaging	Het
Slco5a1	C	T	1: 12,921,185	V427I	probably benign	Het
Ssbp2	A	T	13: 91,690,908	M300L	probably benign	Het
Ssc5d	A	G	7: 4,937,522	D878G	probably damaging	Het
Stk19	A	G	17: 34,824,598	L212P	probably damaging	Het
Syt17	A	C	7: 118,434,243	S181A	probably benign	Het
Taar7b	A	T	10: 23,999,951	N5Y	probably benign	Het
Tmc4	A	G	7: 3,677,422		probably null	Het
Tmem248	T	A	5: 130,229,469	M1K	probably null	Het
Tmem82	T	A	4: 141,616,410	Q183L	probably damaging	Het
Tpd52l1	T	C	10: 31,338,207	E142G	probably damaging	Het
Ttll2	A	T	17: 7,351,768	H253Q	probably damaging	Het
Ttn	T	C	2: 76,857,464		probably benign	Het
Ubd	A	G	17: 37,195,501	K93E	probably benign	Het
Ugt2b35	T	A	5: 87,001,556	F222Y	probably damaging	Het
Vmn2r10	G	T	5: 109,003,462	N95K	probably damaging	Het
Vwa8	T	C	14: 79,197,464	V1775A	probably benign	Het
Zdbf2	A	G	1: 63,307,822	K1787E	possibly damaging	Het
Zfp26	A	T	9: 20,437,286	F661I	probably damaging	Het
Zfp735	A	T	11: 73,711,678	K483*	probably null	Het
Zfp946	A	G	17: 22,454,538	E91G	probably damaging	Het
Zic5	C	A	14: 122,459,749	D485Y	unknown	Het
Zmynd8	A	T	2: 165,838,852	D236E	probably damaging	Het

Other mutations in Stk39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Stk39	APN	2	68314564	missense	possibly damaging	0.81
IGL00966:Stk39	APN	2	68211958	missense	probably benign	0.01
IGL01936:Stk39	APN	2	68314564	missense	probably benign	0.21
IGL02301:Stk39	APN	2	68211962	missense	probably damaging	1.00
IGL02940:Stk39	APN	2	68220899	splice site	probably null
claimjumper	UTSW	2	68314579	missense	probably damaging	0.96
outlaw	UTSW	2	68307039	critical splice donor site	probably null
rustler	UTSW	2	68263303	missense	probably damaging	1.00
R0570:Stk39	UTSW	2	68410048	missense	probably damaging	1.00
R0609:Stk39	UTSW	2	68366167	missense	probably damaging	1.00
R0670:Stk39	UTSW	2	68366182	missense	possibly damaging	0.93
R0980:Stk39	UTSW	2	68392171	missense	probably damaging	1.00
R1024:Stk39	UTSW	2	68410046	missense	probably damaging	1.00
R1573:Stk39	UTSW	2	68390949	missense	probably damaging	1.00
R1713:Stk39	UTSW	2	68307116	splice site	probably benign
R2223:Stk39	UTSW	2	68314579	missense	probably damaging	0.96
R3700:Stk39	UTSW	2	68392118	missense	probably damaging	1.00
R4207:Stk39	UTSW	2	68220920	missense	probably benign	0.42
R4298:Stk39	UTSW	2	68390940	missense	probably damaging	1.00
R4726:Stk39	UTSW	2	68263303	missense	probably damaging	1.00
R4975:Stk39	UTSW	2	68220992	intron	probably benign
R5057:Stk39	UTSW	2	68220948	missense	probably damaging	0.99
R5384:Stk39	UTSW	2	68410039	missense	probably damaging	1.00
R5921:Stk39	UTSW	2	68366105	missense	probably damaging	0.97
R6125:Stk39	UTSW	2	68392124	missense	probably damaging	1.00
R6251:Stk39	UTSW	2	68307039	critical splice donor site	probably null
R6375:Stk39	UTSW	2	68392238	missense	probably benign	0.34
R7057:Stk39	UTSW	2	68410127	missense	possibly damaging	0.88
R7064:Stk39	UTSW	2	68358812	critical splice donor site	probably null
R7691:Stk39	UTSW	2	68471639	missense	probably damaging	0.97
R7921:Stk39	UTSW	2	68307039	critical splice donor site	probably null
R8155:Stk39	UTSW	2	68267066	missense	probably damaging	1.00
R8920:Stk39	UTSW	2	68471847	missense	unknown
R9003:Stk39	UTSW	2	68392118	missense	probably damaging	0.98
R9530:Stk39	UTSW	2	68368411	missense	probably damaging	1.00
R9682:Stk39	UTSW	2	68366105	missense	probably damaging	0.97
R9784:Stk39	UTSW	2	68368431	missense	probably damaging	1.00
Z1176:Stk39	UTSW	2	68392198	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGTGTCACACTGAGACCAC -3'
(R):5'- TGGTAACATTTTGAACACCTCCAG -3'

Sequencing Primer
(F):5'- ACTGAGACCACTGGAACTGCG -3'
(R):5'- CCAGTGAAAGACTTAAATTACAGGC -3'

Posted On

2018-04-27