Incidental Mutation 'R9784:Mgam'
ID 734205
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R9784 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 40628831-40769123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40759090 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 841 (Y841C)
Ref Sequence ENSEMBL: ENSMUSP00000144680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071535
AA Change: Y1587C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: Y1587C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201148
AA Change: Y1587C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: Y1587C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202775
Predicted Effect probably damaging
Transcript: ENSMUST00000202779
AA Change: Y960C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: Y960C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202966
AA Change: Y841C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: Y841C

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Meta Mutation Damage Score 0.8685 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G A 5: 113,190,661 P495L possibly damaging Het
4931440F15Rik A T 11: 29,825,253 V68E probably damaging Het
Acly C T 11: 100,498,286 A557T probably benign Het
Adgrl4 A T 3: 151,509,311 T446S probably damaging Het
AK157302 A G 13: 21,495,598 E98G probably damaging Het
Akap6 A T 12: 53,141,070 T1756S probably damaging Het
Aldh1l1 A G 6: 90,564,442 T273A probably benign Het
Aldh1l2 T A 10: 83,506,750 probably null Het
Alox12 T C 11: 70,252,839 E201G possibly damaging Het
Arhgef16 A G 4: 154,286,965 V257A probably damaging Het
Asxl3 C T 18: 22,517,254 L767F probably benign Het
Atxn7l2 T C 3: 108,203,249 K692R probably null Het
Btbd2 T C 10: 80,648,647 D145G probably damaging Het
Cacna1b A T 2: 24,761,789 M126K possibly damaging Het
Cacna2d2 T A 9: 107,527,147 C1081S probably benign Het
Cass4 T C 2: 172,427,833 S612P probably benign Het
Cd209d A G 8: 3,876,337 S123P probably damaging Het
Cep112 T C 11: 108,570,391 S665P probably damaging Het
Cnp C T 11: 100,576,611 R127W probably damaging Het
Col9a2 A T 4: 121,041,029 D46V unknown Het
Cyp1a2 T A 9: 57,680,279 N336I probably benign Het
Cyp2c37 A G 19: 40,000,499 T301A possibly damaging Het
Dhtkd1 T A 2: 5,930,811 E163D probably benign Het
Dido1 A T 2: 180,683,561 F611L probably benign Het
Dnah9 T A 11: 66,085,134 N1363I probably damaging Het
Drg2 A G 11: 60,467,722 K331R probably benign Het
Fam171b T A 2: 83,860,443 I250K probably damaging Het
Fut8 T A 12: 77,412,839 I242N probably damaging Het
Glyat T C 19: 12,651,480 V247A probably benign Het
Gucy2e T C 11: 69,232,690 N461S probably benign Het
Hif3a T A 7: 17,037,151 H627L probably benign Het
Ighv8-5 T A 12: 115,067,608 T104S probably benign Het
Ighv8-9 C T 12: 115,468,374 V106M probably benign Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Katna1 G C 10: 7,762,826 E440D probably null Het
Kmt2c T C 5: 25,344,961 R1341G probably damaging Het
Krt14 C T 11: 100,207,140 G106S unknown Het
Krt39 A G 11: 99,518,362 C238R possibly damaging Het
Mak C T 13: 41,049,360 S204N possibly damaging Het
Map3k5 A G 10: 19,935,066 Y154C probably damaging Het
Mgst1 A T 6: 138,147,801 R38W probably damaging Het
Midn A G 10: 80,156,413 E433G probably damaging Het
Muc2 T A 7: 141,694,542 C380* probably null Het
Nans G T 4: 46,499,129 K145N possibly damaging Het
Nbeal1 G A 1: 60,260,582 W1359* probably null Het
Neo1 T A 9: 58,982,220 E256V probably benign Het
Nkd1 C A 8: 88,591,702 D322E probably damaging Het
Olfm4 T C 14: 80,011,908 V155A probably damaging Het
Olfr1303 A G 2: 111,814,259 S156P probably damaging Het
Olfr1445 G A 19: 12,884,510 V210M probably benign Het
Olfr1461 T A 19: 13,165,449 L145Q probably damaging Het
Olfr409-ps1 G T 11: 74,317,883 C286F unknown Het
Olfr613 T A 7: 103,552,059 H91Q probably benign Het
Olfr67 T A 7: 103,787,525 I251F probably benign Het
Olfr847 A T 9: 19,375,820 D20E probably damaging Het
Opa1 C A 16: 29,618,211 S646* probably null Het
Pcdh15 A T 10: 74,631,380 H1743L probably benign Het
Ppp1r13b T C 12: 111,843,685 T230A probably benign Het
Ptf1a G T 2: 19,446,570 R237L probably benign Het
Ripk4 G A 16: 97,748,106 P250L possibly damaging Het
Ropn1l T C 15: 31,453,503 H14R Het
Setdb1 T C 3: 95,325,862 S1122G probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc22a18 T A 7: 143,492,941 M274K probably benign Het
Spink5 T G 18: 43,986,423 F267C probably damaging Het
Stau1 T C 2: 166,949,775 M481V probably benign Het
Stk39 C T 2: 68,368,431 G281E probably damaging Het
Stt3a A T 9: 36,758,783 L119Q probably damaging Het
Stx18 C T 5: 38,039,291 probably benign Het
Tgfbr3 G T 5: 107,149,933 N200K probably benign Het
Timm8b A G 9: 50,604,973 E42G probably benign Het
Togaram1 T A 12: 64,967,394 L473* probably null Het
Trappc12 A G 12: 28,747,458 I25T probably benign Het
Trim33 T C 3: 103,337,507 S737P possibly damaging Het
Trmt1 A C 8: 84,697,701 H455P probably damaging Het
Trpc1 C T 9: 95,717,593 R471H possibly damaging Het
Ttll2 T A 17: 7,351,308 T407S probably benign Het
Unc45b T A 11: 82,926,160 N475K probably damaging Het
Usp48 T A 4: 137,594,501 I40N probably benign Het
Wdr7 T G 18: 63,904,165 V1220G probably damaging Het
Zfp830 C T 11: 82,764,979 T203I possibly damaging Het
Zfp955a T A 17: 33,242,175 I328F probably damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
BB002:Mgam UTSW 6 40759051 missense probably damaging 0.99
BB012:Mgam UTSW 6 40759051 missense probably damaging 0.99
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 splice site probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 splice site probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 splice site probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7925:Mgam UTSW 6 40759051 missense probably damaging 0.99
R8206:Mgam UTSW 6 40680235 missense probably benign 0.00
R8244:Mgam UTSW 6 40750586 missense probably damaging 1.00
R8309:Mgam UTSW 6 40745177 missense possibly damaging 0.88
R8472:Mgam UTSW 6 40694526 splice site probably null
R8758:Mgam UTSW 6 40729043 missense probably benign 0.41
R8777:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8783:Mgam UTSW 6 40656489 missense probably damaging 0.99
R8939:Mgam UTSW 6 40763203 critical splice donor site probably null
R8968:Mgam UTSW 6 40757811 critical splice acceptor site probably null
R8987:Mgam UTSW 6 40729636 missense probably damaging 1.00
R9055:Mgam UTSW 6 40714729 intron probably benign
R9171:Mgam UTSW 6 40768212 missense possibly damaging 0.76
R9252:Mgam UTSW 6 40729643 missense probably damaging 0.99
R9258:Mgam UTSW 6 40680187 missense probably benign
R9262:Mgam UTSW 6 40746488 critical splice donor site probably null
R9287:Mgam UTSW 6 40728971 intron probably benign
R9521:Mgam UTSW 6 40745184 missense probably damaging 1.00
R9589:Mgam UTSW 6 40750585 missense probably damaging 1.00
R9658:Mgam UTSW 6 40744377 missense possibly damaging 0.93
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTACTGAGAATATTCTTGAGTCCAG -3'
(R):5'- ACCTTCTATCCAAGATCTGTGGTATG -3'

Sequencing Primer
(F):5'- GAATATTCTTGAGTCCAGTTGCAGAG -3'
(R):5'- AAGAGGAAATAAAGTATTCTCTCTGC -3'
Posted On 2022-11-14