Incidental Mutation 'R0782:Cspp1'
ID76662
Institutional Source Beutler Lab
Gene Symbol Cspp1
Ensembl Gene ENSMUSG00000056763
Gene Namecentrosome and spindle pole associated protein 1
Synonyms2310020J12Rik, 4930413O22Rik
MMRRC Submission 038962-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R0782 (G1)
Quality Score171
Status Validated
Chromosome1
Chromosomal Location10037987-10136768 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 10129974 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071087] [ENSMUST00000186294] [ENSMUST00000187226]
Predicted Effect probably benign
Transcript: ENSMUST00000071087
SMART Domains Protein: ENSMUSP00000068804
Gene: ENSMUSG00000056763

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
coiled coil region 349 383 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 465 484 N/A INTRINSIC
coiled coil region 568 610 N/A INTRINSIC
Pfam:CCDC66 661 810 2e-11 PFAM
coiled coil region 866 903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148663
Predicted Effect probably benign
Transcript: ENSMUST00000186294
SMART Domains Protein: ENSMUSP00000139775
Gene: ENSMUSG00000056763

DomainStartEndE-ValueType
low complexity region 266 281 N/A INTRINSIC
coiled coil region 345 379 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 461 480 N/A INTRINSIC
SCOP:d1eq1a_ 567 748 4e-3 SMART
coiled coil region 811 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187226
SMART Domains Protein: ENSMUSP00000140076
Gene: ENSMUSG00000056763

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
coiled coil region 98 135 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome and spindle pole associated protein. The encoded protein plays a role in cell-cycle progression and spindle organization, regulates cytokinesis, interacts with Nephrocystin 8 and is required for cilia formation. Mutations in this gene result in primary cilia abnormalities and classical Joubert syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap23 C T 11: 97,500,554 P1299L possibly damaging Het
B3glct C T 5: 149,726,810 T126M probably damaging Het
Baz1a A T 12: 54,894,488 D1492E probably damaging Het
Cdc14a A G 3: 116,322,136 I259T probably damaging Het
Cog7 C A 7: 121,943,797 A464S possibly damaging Het
Csf2rb2 C A 15: 78,286,751 K368N probably damaging Het
Cyp2c37 A G 19: 39,993,825 H90R probably benign Het
Dcst1 A G 3: 89,357,500 F314L possibly damaging Het
Dhx36 A T 3: 62,506,714 probably benign Het
Efr3b G A 12: 3,984,686 probably benign Het
Faap100 A G 11: 120,376,704 probably null Het
Hmcn1 A G 1: 150,753,665 I947T possibly damaging Het
Ilkap C T 1: 91,378,550 R103H probably damaging Het
Impa1 A T 3: 10,322,896 probably benign Het
Kbtbd8 C T 6: 95,122,232 R164C probably damaging Het
Lactb2 T G 1: 13,647,451 N116T probably benign Het
Myh8 T A 11: 67,289,754 N605K probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Napa T C 7: 16,115,267 M244T probably benign Het
Nckap5 G A 1: 125,981,541 S1719F probably damaging Het
Nfe2l2 T C 2: 75,676,833 I308V probably benign Het
Olfr609 C A 7: 103,492,515 R121L probably damaging Het
Ppfia2 C T 10: 106,927,731 S1195L probably benign Het
Rasa4 A G 5: 136,104,532 K615R possibly damaging Het
Rnf216 T C 5: 143,068,892 K634E possibly damaging Het
Samd3 A G 10: 26,270,240 T388A probably damaging Het
Serping1 G A 2: 84,767,446 P364S probably damaging Het
Slc39a10 T C 1: 46,835,996 S49G probably damaging Het
Smc2 C A 4: 52,469,799 T762K probably benign Het
Smpd1 T A 7: 105,555,343 V143E possibly damaging Het
Synj2bp A T 12: 81,532,733 L16Q probably damaging Het
Tcof1 G A 18: 60,816,280 R1188W probably damaging Het
Unc80 A G 1: 66,622,581 R1722G possibly damaging Het
Vamp5 T C 6: 72,369,470 S48G probably damaging Het
Vps13d G A 4: 145,126,625 probably benign Het
Zfp292 T C 4: 34,839,382 N161S possibly damaging Het
Zfp831 A G 2: 174,646,630 T1033A probably benign Het
Other mutations in Cspp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cspp1 APN 1 10112551 unclassified probably benign
IGL01070:Cspp1 APN 1 10088145 missense probably damaging 0.99
IGL01384:Cspp1 APN 1 10116680 missense probably damaging 1.00
IGL01400:Cspp1 APN 1 10085931 missense probably damaging 0.99
IGL01893:Cspp1 APN 1 10134141 splice site probably null
IGL01909:Cspp1 APN 1 10066661 missense probably benign 0.01
IGL02229:Cspp1 APN 1 10083556 missense probably damaging 1.00
IGL02397:Cspp1 APN 1 10108465 missense possibly damaging 0.66
IGL02983:Cspp1 APN 1 10127525 missense probably benign 0.34
IGL03352:Cspp1 APN 1 10047437 missense possibly damaging 0.93
PIT4453001:Cspp1 UTSW 1 10074872 missense possibly damaging 0.83
R0312:Cspp1 UTSW 1 10058829 splice site probably benign
R0931:Cspp1 UTSW 1 10104286 missense probably damaging 0.98
R1499:Cspp1 UTSW 1 10088966 splice site probably null
R1553:Cspp1 UTSW 1 10085897 missense possibly damaging 0.94
R1613:Cspp1 UTSW 1 10133241 missense probably damaging 1.00
R1644:Cspp1 UTSW 1 10126438 missense probably damaging 0.99
R2042:Cspp1 UTSW 1 10112538 missense probably damaging 0.98
R2090:Cspp1 UTSW 1 10090268 missense possibly damaging 0.89
R2178:Cspp1 UTSW 1 10104246 missense possibly damaging 0.81
R2247:Cspp1 UTSW 1 10066460 missense possibly damaging 0.87
R2680:Cspp1 UTSW 1 10104305 missense probably damaging 1.00
R3803:Cspp1 UTSW 1 10126373 missense probably damaging 1.00
R4520:Cspp1 UTSW 1 10134227 missense probably benign 0.11
R4531:Cspp1 UTSW 1 10066847 intron probably benign
R4906:Cspp1 UTSW 1 10082328 missense possibly damaging 0.82
R4960:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4973:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4976:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4978:Cspp1 UTSW 1 10083517 missense possibly damaging 0.66
R4979:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4981:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4983:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5032:Cspp1 UTSW 1 10066519 missense probably benign 0.07
R5057:Cspp1 UTSW 1 10074961 splice site probably benign
R5081:Cspp1 UTSW 1 10047466 missense possibly damaging 0.57
R5119:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5121:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5146:Cspp1 UTSW 1 10074876 nonsense probably null
R5373:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R5374:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R6230:Cspp1 UTSW 1 10077197 missense probably benign 0.01
R6291:Cspp1 UTSW 1 10064334 missense probably damaging 0.97
R6382:Cspp1 UTSW 1 10083475 splice site probably null
R7135:Cspp1 UTSW 1 10088936 missense possibly damaging 0.92
R7388:Cspp1 UTSW 1 10065347 nonsense probably null
R7647:Cspp1 UTSW 1 10135937 missense probably benign 0.26
R7722:Cspp1 UTSW 1 10074901 missense probably benign 0.00
R8039:Cspp1 UTSW 1 10113013 missense probably benign 0.02
R8087:Cspp1 UTSW 1 10104264 missense possibly damaging 0.81
R8339:Cspp1 UTSW 1 10113667 missense probably damaging 1.00
R8719:Cspp1 UTSW 1 10090291 missense possibly damaging 0.83
R8774:Cspp1 UTSW 1 10112914 missense possibly damaging 0.46
R8774-TAIL:Cspp1 UTSW 1 10112914 missense possibly damaging 0.46
Z1088:Cspp1 UTSW 1 10083546 missense possibly damaging 0.81
Z1177:Cspp1 UTSW 1 10095878 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TACCTCTACAGAGCCCTGTGGTTG -3'
(R):5'- AGCTCAAGGCACTCAGGTGTTATTC -3'

Sequencing Primer
(F):5'- CAATCTGTAGTGGCTCCACTGAG -3'
(R):5'- AGGTGTTATTCTCACCCATTACAG -3'
Posted On2013-10-16