Incidental Mutation 'R2247:Cspp1'
ID240881
Institutional Source Beutler Lab
Gene Symbol Cspp1
Ensembl Gene ENSMUSG00000056763
Gene Namecentrosome and spindle pole associated protein 1
Synonyms2310020J12Rik, 4930413O22Rik
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location10037987-10136768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10066460 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 182 (Q182L)
Ref Sequence ENSEMBL: ENSMUSP00000113663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071087] [ENSMUST00000117415] [ENSMUST00000118263] [ENSMUST00000119714] [ENSMUST00000122156] [ENSMUST00000186294]
Predicted Effect probably benign
Transcript: ENSMUST00000071087
AA Change: Q174L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000068804
Gene: ENSMUSG00000056763
AA Change: Q174L

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
coiled coil region 349 383 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 465 484 N/A INTRINSIC
coiled coil region 568 610 N/A INTRINSIC
Pfam:CCDC66 661 810 2e-11 PFAM
coiled coil region 866 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117415
AA Change: Q174L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112800
Gene: ENSMUSG00000056763
AA Change: Q174L

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118263
AA Change: Q174L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112476
Gene: ENSMUSG00000056763
AA Change: Q174L

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119714
AA Change: Q174L

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000114091
Gene: ENSMUSG00000056763
AA Change: Q174L

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122156
AA Change: Q182L

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113663
Gene: ENSMUSG00000056763
AA Change: Q182L

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 278 293 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143606
Predicted Effect unknown
Transcript: ENSMUST00000149214
AA Change: Q114L
Predicted Effect possibly damaging
Transcript: ENSMUST00000186294
AA Change: Q170L

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139775
Gene: ENSMUSG00000056763
AA Change: Q170L

DomainStartEndE-ValueType
low complexity region 266 281 N/A INTRINSIC
coiled coil region 345 379 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 461 480 N/A INTRINSIC
SCOP:d1eq1a_ 567 748 4e-3 SMART
coiled coil region 811 848 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190318
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome and spindle pole associated protein. The encoded protein plays a role in cell-cycle progression and spindle organization, regulates cytokinesis, interacts with Nephrocystin 8 and is required for cilia formation. Mutations in this gene result in primary cilia abnormalities and classical Joubert syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Cspp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cspp1 APN 1 10112551 unclassified probably benign
IGL01070:Cspp1 APN 1 10088145 missense probably damaging 0.99
IGL01384:Cspp1 APN 1 10116680 missense probably damaging 1.00
IGL01400:Cspp1 APN 1 10085931 missense probably damaging 0.99
IGL01893:Cspp1 APN 1 10134141 splice site probably null
IGL01909:Cspp1 APN 1 10066661 missense probably benign 0.01
IGL02229:Cspp1 APN 1 10083556 missense probably damaging 1.00
IGL02397:Cspp1 APN 1 10108465 missense possibly damaging 0.66
IGL02983:Cspp1 APN 1 10127525 missense probably benign 0.34
IGL03352:Cspp1 APN 1 10047437 missense possibly damaging 0.93
PIT4453001:Cspp1 UTSW 1 10074872 missense possibly damaging 0.83
R0312:Cspp1 UTSW 1 10058829 splice site probably benign
R0782:Cspp1 UTSW 1 10129974 splice site probably benign
R0931:Cspp1 UTSW 1 10104286 missense probably damaging 0.98
R1499:Cspp1 UTSW 1 10088966 splice site probably null
R1553:Cspp1 UTSW 1 10085897 missense possibly damaging 0.94
R1613:Cspp1 UTSW 1 10133241 missense probably damaging 1.00
R1644:Cspp1 UTSW 1 10126438 missense probably damaging 0.99
R2042:Cspp1 UTSW 1 10112538 missense probably damaging 0.98
R2090:Cspp1 UTSW 1 10090268 missense possibly damaging 0.89
R2178:Cspp1 UTSW 1 10104246 missense possibly damaging 0.81
R2680:Cspp1 UTSW 1 10104305 missense probably damaging 1.00
R3803:Cspp1 UTSW 1 10126373 missense probably damaging 1.00
R4520:Cspp1 UTSW 1 10134227 missense probably benign 0.11
R4531:Cspp1 UTSW 1 10066847 intron probably benign
R4906:Cspp1 UTSW 1 10082328 missense possibly damaging 0.82
R4960:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4973:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4976:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4978:Cspp1 UTSW 1 10083517 missense possibly damaging 0.66
R4979:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4981:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4983:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5032:Cspp1 UTSW 1 10066519 missense probably benign 0.07
R5057:Cspp1 UTSW 1 10074961 splice site probably benign
R5081:Cspp1 UTSW 1 10047466 missense possibly damaging 0.57
R5119:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5121:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5146:Cspp1 UTSW 1 10074876 nonsense probably null
R5373:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R5374:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R6230:Cspp1 UTSW 1 10077197 missense probably benign 0.01
R6291:Cspp1 UTSW 1 10064334 missense probably damaging 0.97
R6382:Cspp1 UTSW 1 10083475 splice site probably null
R7135:Cspp1 UTSW 1 10088936 missense possibly damaging 0.92
R7388:Cspp1 UTSW 1 10065347 nonsense probably null
R7647:Cspp1 UTSW 1 10135937 missense probably benign 0.26
R7722:Cspp1 UTSW 1 10074901 missense probably benign 0.00
R8039:Cspp1 UTSW 1 10113013 missense probably benign 0.02
R8087:Cspp1 UTSW 1 10104264 missense possibly damaging 0.81
R8339:Cspp1 UTSW 1 10113667 missense probably damaging 1.00
Z1088:Cspp1 UTSW 1 10083546 missense possibly damaging 0.81
Z1177:Cspp1 UTSW 1 10095878 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAATAACTGAAGGATGGAGTTCTTT -3'
(R):5'- TGCACCAGAAATGCCTACTT -3'

Sequencing Primer
(F):5'- AGCCCGTGGAGTCCATTTAATATTG -3'
(R):5'- GCACCAGAAATGCCTACTTCTTCC -3'
Posted On2014-10-15