Incidental Mutation 'R5121:Cspp1'
ID 392972
Institutional Source Beutler Lab
Gene Symbol Cspp1
Ensembl Gene ENSMUSG00000056763
Gene Name centrosome and spindle pole associated protein 1
Synonyms 2310020J12Rik, 4930413O22Rik
MMRRC Submission 042709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R5121 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 10037987-10136768 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10126463 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 900 (N900K)
Ref Sequence ENSEMBL: ENSMUSP00000139775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071087] [ENSMUST00000186294] [ENSMUST00000187226]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071087
AA Change: N955K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068804
Gene: ENSMUSG00000056763
AA Change: N955K

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
coiled coil region 349 383 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 465 484 N/A INTRINSIC
coiled coil region 568 610 N/A INTRINSIC
Pfam:CCDC66 661 810 2e-11 PFAM
coiled coil region 866 903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136898
Predicted Effect probably damaging
Transcript: ENSMUST00000186294
AA Change: N900K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139775
Gene: ENSMUSG00000056763
AA Change: N900K

DomainStartEndE-ValueType
low complexity region 266 281 N/A INTRINSIC
coiled coil region 345 379 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 461 480 N/A INTRINSIC
SCOP:d1eq1a_ 567 748 4e-3 SMART
coiled coil region 811 848 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187226
AA Change: N187K

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140076
Gene: ENSMUSG00000056763
AA Change: N187K

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
coiled coil region 98 135 N/A INTRINSIC
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome and spindle pole associated protein. The encoded protein plays a role in cell-cycle progression and spindle organization, regulates cytokinesis, interacts with Nephrocystin 8 and is required for cilia formation. Mutations in this gene result in primary cilia abnormalities and classical Joubert syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c A G 2: 58,281,650 I234T probably damaging Het
Adam24 A G 8: 40,679,511 E6G probably damaging Het
Amz1 A G 5: 140,744,164 D151G probably benign Het
Arhgap24 T C 5: 102,841,335 L10P probably damaging Het
Arhgap25 T G 6: 87,532,864 N8T probably benign Het
Arsi T G 18: 60,917,439 F465V probably damaging Het
Atp2c1 A G 9: 105,448,825 V293A probably damaging Het
Bzw2 A G 12: 36,104,351 L340P probably damaging Het
Camkmt C T 17: 85,096,581 T77I probably benign Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Cd163 T C 6: 124,317,989 C671R probably damaging Het
Cdk7 T C 13: 100,717,684 probably null Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Chn2 C T 6: 54,218,561 L72F possibly damaging Het
Cntn2 C A 1: 132,517,060 E363* probably null Het
Crebbp T C 16: 4,093,511 E999G probably damaging Het
Cts3 A C 13: 61,567,595 I141M probably benign Het
Cwc27 A T 13: 104,804,353 V166D probably damaging Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Dnah8 A G 17: 30,810,353 T4099A probably benign Het
Eml6 A G 11: 29,744,606 F1953L probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
Fbln1 A G 15: 85,237,671 E331G probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gcat T C 15: 79,035,282 V149A probably damaging Het
Glp2r A T 11: 67,722,100 probably null Het
Gm572 T C 4: 148,666,845 probably null Het
Golgb1 T C 16: 36,919,258 V2653A probably damaging Het
Grap2 G A 15: 80,646,144 R155Q possibly damaging Het
Gspt1 T A 16: 11,223,301 I533L probably damaging Het
Gypa A T 8: 80,496,348 Y27F unknown Het
Hipk4 G A 7: 27,529,492 V456I probably benign Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Hspa1b A T 17: 34,958,004 V335E possibly damaging Het
Ift122 A G 6: 115,912,534 T827A probably benign Het
Igkv1-35 T C 6: 70,011,135 N58S probably benign Het
Kat6b A T 14: 21,619,258 H297L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Lrrn1 G T 6: 107,569,207 R655S possibly damaging Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Mill2 G A 7: 18,856,666 G209S probably benign Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mphosph10 A G 7: 64,389,596 S209P probably damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo15b C T 11: 115,886,054 R867W probably damaging Het
Myo18b A T 5: 112,874,480 probably benign Het
Nip7 A G 8: 107,056,957 E8G possibly damaging Het
Olfr1318 A T 2: 112,156,286 M112L possibly damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr38 T A 6: 42,762,997 L315* probably null Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr711 T C 7: 106,972,231 I38V probably benign Het
Optn T A 2: 5,046,106 I155F probably benign Het
Papolb A T 5: 142,528,837 H350Q probably benign Het
Pappa2 T A 1: 158,838,627 M1128L probably benign Het
Pcdhb5 T A 18: 37,321,117 N183K probably benign Het
Pde12 G T 14: 26,669,422 S44* probably null Het
Peg3 T C 7: 6,710,289 K645E probably benign Het
Pkd1 C T 17: 24,573,463 R1375C probably benign Het
Plekha5 G A 6: 140,579,474 E21K probably damaging Het
Plk2 C T 13: 110,399,424 P554L probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Polg A T 7: 79,464,605 W203R probably damaging Het
Ppcdc A G 9: 57,421,163 V65A possibly damaging Het
Ppm1m T A 9: 106,195,805 Q353L probably benign Het
Ppp1r13l G C 7: 19,370,095 R167P probably damaging Het
Ppp1r9b T A 11: 94,996,653 V497E probably damaging Het
Prpf6 T A 2: 181,636,043 H399Q probably benign Het
Psg25 T A 7: 18,526,536 I146F possibly damaging Het
Rasgef1c A T 11: 49,960,429 Q116L probably damaging Het
Rbbp9 A G 2: 144,550,756 V8A possibly damaging Het
Rfk T C 19: 17,399,566 F144S probably damaging Het
Rfwd3 A C 8: 111,282,753 probably null Het
Rhpn1 T C 15: 75,709,260 I117T probably damaging Het
Sars2 A T 7: 28,747,908 N244Y probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sgcz G A 8: 37,539,667 T195I probably damaging Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Spen T A 4: 141,476,099 Q1739L probably benign Het
Susd1 G T 4: 59,379,657 S323R possibly damaging Het
Szt2 T C 4: 118,385,444 E1482G possibly damaging Het
Tex15 A T 8: 33,571,766 K408I probably damaging Het
Tex33 C T 15: 78,386,173 E132K probably benign Het
Trem1 T A 17: 48,232,836 F14L probably null Het
Trim26 G T 17: 36,851,066 E126* probably null Het
Trpv3 T C 11: 73,277,834 probably null Het
Ttn T A 2: 76,916,491 probably null Het
Ubap1 C T 4: 41,379,688 L301F probably benign Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Vill C T 9: 119,070,025 T253I possibly damaging Het
Vmn2r107 C T 17: 20,355,753 T115I probably benign Het
Vmn2r98 T C 17: 19,053,553 S21P probably benign Het
Wapl A G 14: 34,677,162 K63E probably benign Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Zfp592 T C 7: 81,023,561 L91P probably damaging Het
Zfp74 T C 7: 29,932,507 probably null Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zranb1 A G 7: 132,950,187 E215G probably benign Het
Other mutations in Cspp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cspp1 APN 1 10112551 unclassified probably benign
IGL01070:Cspp1 APN 1 10088145 missense probably damaging 0.99
IGL01384:Cspp1 APN 1 10116680 missense probably damaging 1.00
IGL01400:Cspp1 APN 1 10085931 missense probably damaging 0.99
IGL01893:Cspp1 APN 1 10134141 splice site probably null
IGL01909:Cspp1 APN 1 10066661 missense probably benign 0.01
IGL02229:Cspp1 APN 1 10083556 missense probably damaging 1.00
IGL02397:Cspp1 APN 1 10108465 missense possibly damaging 0.66
IGL02983:Cspp1 APN 1 10127525 missense probably benign 0.34
IGL03352:Cspp1 APN 1 10047437 missense possibly damaging 0.93
PIT4453001:Cspp1 UTSW 1 10074872 missense possibly damaging 0.83
R0312:Cspp1 UTSW 1 10058829 splice site probably benign
R0782:Cspp1 UTSW 1 10129974 splice site probably benign
R0931:Cspp1 UTSW 1 10104286 missense probably damaging 0.98
R1499:Cspp1 UTSW 1 10088966 splice site probably null
R1553:Cspp1 UTSW 1 10085897 missense possibly damaging 0.94
R1613:Cspp1 UTSW 1 10133241 missense probably damaging 1.00
R1644:Cspp1 UTSW 1 10126438 missense probably damaging 0.99
R2042:Cspp1 UTSW 1 10112538 missense probably damaging 0.98
R2090:Cspp1 UTSW 1 10090268 missense possibly damaging 0.89
R2178:Cspp1 UTSW 1 10104246 missense possibly damaging 0.81
R2247:Cspp1 UTSW 1 10066460 missense possibly damaging 0.87
R2680:Cspp1 UTSW 1 10104305 missense probably damaging 1.00
R3803:Cspp1 UTSW 1 10126373 missense probably damaging 1.00
R4520:Cspp1 UTSW 1 10134227 missense probably benign 0.11
R4531:Cspp1 UTSW 1 10066847 intron probably benign
R4906:Cspp1 UTSW 1 10082328 missense possibly damaging 0.82
R4960:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4973:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4976:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4978:Cspp1 UTSW 1 10083517 missense possibly damaging 0.66
R4979:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4981:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R4983:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5032:Cspp1 UTSW 1 10066519 missense probably benign 0.07
R5057:Cspp1 UTSW 1 10074961 splice site probably benign
R5081:Cspp1 UTSW 1 10047466 missense possibly damaging 0.57
R5119:Cspp1 UTSW 1 10126463 missense probably damaging 1.00
R5146:Cspp1 UTSW 1 10074876 nonsense probably null
R5373:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R5374:Cspp1 UTSW 1 10134126 missense probably damaging 1.00
R6230:Cspp1 UTSW 1 10077197 missense probably benign 0.01
R6291:Cspp1 UTSW 1 10064334 missense probably damaging 0.97
R6382:Cspp1 UTSW 1 10083475 splice site probably null
R7135:Cspp1 UTSW 1 10088936 missense possibly damaging 0.92
R7388:Cspp1 UTSW 1 10065347 nonsense probably null
R7647:Cspp1 UTSW 1 10135937 missense probably benign 0.26
R7722:Cspp1 UTSW 1 10074901 missense probably benign 0.00
R8039:Cspp1 UTSW 1 10113013 missense probably benign 0.02
R8087:Cspp1 UTSW 1 10104264 missense possibly damaging 0.81
R8339:Cspp1 UTSW 1 10113667 missense probably damaging 1.00
R8719:Cspp1 UTSW 1 10090291 missense possibly damaging 0.83
R8774:Cspp1 UTSW 1 10112914 missense possibly damaging 0.46
R8774-TAIL:Cspp1 UTSW 1 10112914 missense possibly damaging 0.46
R8979:Cspp1 UTSW 1 10064405 missense probably benign 0.27
R9068:Cspp1 UTSW 1 10077244 critical splice donor site probably null
R9071:Cspp1 UTSW 1 10088896 missense possibly damaging 0.66
R9080:Cspp1 UTSW 1 10113694 missense probably benign 0.25
R9139:Cspp1 UTSW 1 10116650 missense probably damaging 0.99
R9630:Cspp1 UTSW 1 10038067 start gained probably benign
R9685:Cspp1 UTSW 1 10126414 missense probably benign 0.35
Z1088:Cspp1 UTSW 1 10083546 missense possibly damaging 0.81
Z1177:Cspp1 UTSW 1 10095878 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTCTGGTCAAAGATGCCAAGT -3'
(R):5'- AGACATTACAAAGCCATGAAATTGAA -3'

Sequencing Primer
(F):5'- GAACAGAATGTCAGCTCGTTTCC -3'
(R):5'- TACAAAGCCATGAAATTGAAGAACAC -3'
Posted On 2016-06-15