Mutagenetix > Incidental Mutation

Incidental Mutation 'R0776:Rpgrip1'

76988

Institutional Source

Beutler Lab

Gene Symbol

Rpgrip1

Ensembl Gene

ENSMUSG00000057132

Gene Name

retinitis pigmentosa GTPase regulator interacting protein 1

Synonyms

A930002K18Rik, 4930505G06Rik, nmf247, 4930401L23Rik

MMRRC Submission

038956-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.232) question?

Stock #

R0776 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52348161-52401003 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52378626 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 517 (D517G)

Ref Sequence

ENSEMBL: ENSMUSP00000138027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181401]

AlphaFold

Q9EPQ2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111600
AA Change: D517G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132
AA Change: D517G

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
coiled coil region	248	348	N/A	INTRINSIC
coiled coil region	499	542	N/A	INTRINSIC
C2	602	707	1.08e-2	SMART
coiled coil region	746	795	N/A	INTRINSIC
Blast:C2	958	1086	1e-37	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111603
AA Change: D517G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132
AA Change: D517G

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
coiled coil region	248	348	N/A	INTRINSIC
coiled coil region	499	543	N/A	INTRINSIC
Pfam:C2-C2_1	582	721	1.9e-49	PFAM
C2	764	869	7.3e-5	SMART
coiled coil region	910	999	N/A	INTRINSIC
Blast:C2	1162	1290	2e-37	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000180513

Predicted Effect

probably benign
Transcript: ENSMUST00000180646

SMART Domains

Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
coiled coil region	248	276	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180901

SMART Domains

Protein: ENSMUSP00000137826
Gene: ENSMUSG00000057132

Domain	Start	End	E-Value	Type
coiled coil region	179	223	N/A	INTRINSIC
coiled coil region	274	363	N/A	INTRINSIC
Blast:C2	526	654	2e-38	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181297

SMART Domains

Protein: ENSMUSP00000137653
Gene: ENSMUSG00000057132

Domain	Start	End	E-Value	Type
coiled coil region	180	224	N/A	INTRINSIC
low complexity region	257	284	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000181401
AA Change: D517G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132
AA Change: D517G

Domain	Start	End	E-Value	Type
low complexity region	98	119	N/A	INTRINSIC
coiled coil region	248	348	N/A	INTRINSIC
coiled coil region	499	547	N/A	INTRINSIC
Pfam:DUF3250	605	710	2.8e-46	PFAM
C2	753	858	1.08e-2	SMART
coiled coil region	899	988	N/A	INTRINSIC
Blast:C2	1151	1279	1e-37	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181823

Predicted Effect

probably benign
Transcript: ENSMUST00000181627

Predicted Effect

probably benign
Transcript: ENSMUST00000181709

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.0%
20x: 90.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 3 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cald1	AAGAGAGAGAGAGAG	AAGAGAGAGAGAG	6: 34,723,108 (GRCm39)		probably null	Het
Muc4	C	G	16: 32,574,020 (GRCm39)	S699R	probably benign	Het
Sis	T	C	3: 72,859,864 (GRCm39)	Q297R	probably damaging	Het

Other mutations in Rpgrip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Rpgrip1	APN	14	52,387,895 (GRCm39)	splice site	probably null
IGL01016:Rpgrip1	APN	14	52,383,293 (GRCm39)	missense	probably damaging	1.00
IGL01019:Rpgrip1	APN	14	52,368,633 (GRCm39)	missense	possibly damaging	0.70
IGL01382:Rpgrip1	APN	14	52,382,934 (GRCm39)	missense	possibly damaging	0.93
IGL01433:Rpgrip1	APN	14	52,363,834 (GRCm39)	missense	probably damaging	1.00
IGL01528:Rpgrip1	APN	14	52,349,634 (GRCm39)	nonsense	probably null
IGL01548:Rpgrip1	APN	14	52,363,728 (GRCm39)	splice site	probably benign
IGL01652:Rpgrip1	APN	14	52,382,949 (GRCm39)	unclassified	probably benign
IGL02040:Rpgrip1	APN	14	52,358,476 (GRCm39)	missense	possibly damaging	0.86
IGL02113:Rpgrip1	APN	14	52,371,301 (GRCm39)	missense	possibly damaging	0.85
IGL02121:Rpgrip1	APN	14	52,384,831 (GRCm39)	missense	possibly damaging	0.89
IGL02185:Rpgrip1	APN	14	52,349,685 (GRCm39)	missense	possibly damaging	0.72
IGL02234:Rpgrip1	APN	14	52,368,766 (GRCm39)	splice site	probably benign
IGL02322:Rpgrip1	APN	14	52,387,499 (GRCm39)	missense	possibly damaging	0.89
IGL02379:Rpgrip1	APN	14	52,376,345 (GRCm39)	missense	possibly damaging	0.53
IGL02524:Rpgrip1	APN	14	52,358,511 (GRCm39)	missense	probably benign	0.01
IGL02836:Rpgrip1	APN	14	52,382,714 (GRCm39)	splice site	probably null
IGL03264:Rpgrip1	APN	14	52,378,109 (GRCm39)	missense	possibly damaging	0.53
IGL03410:Rpgrip1	APN	14	52,395,823 (GRCm39)	unclassified	probably benign
FR4976:Rpgrip1	UTSW	14	52,387,001 (GRCm39)	utr 3 prime	probably benign
FR4976:Rpgrip1	UTSW	14	52,386,851 (GRCm39)	utr 3 prime	probably benign
R0045:Rpgrip1	UTSW	14	52,378,601 (GRCm39)	missense	possibly damaging	0.53
R0045:Rpgrip1	UTSW	14	52,378,601 (GRCm39)	missense	possibly damaging	0.53
R0089:Rpgrip1	UTSW	14	52,386,841 (GRCm39)	utr 3 prime	probably benign
R0498:Rpgrip1	UTSW	14	52,368,771 (GRCm39)	splice site	probably benign
R0602:Rpgrip1	UTSW	14	52,371,313 (GRCm39)	missense	possibly damaging	0.72
R1139:Rpgrip1	UTSW	14	52,384,678 (GRCm39)	missense	probably benign	0.33
R1528:Rpgrip1	UTSW	14	52,349,681 (GRCm39)	missense	probably benign	0.01
R1715:Rpgrip1	UTSW	14	52,378,148 (GRCm39)	missense	possibly damaging	0.53
R1934:Rpgrip1	UTSW	14	52,352,101 (GRCm39)	missense	possibly damaging	0.53
R2087:Rpgrip1	UTSW	14	52,374,079 (GRCm39)	splice site	probably null
R2114:Rpgrip1	UTSW	14	52,387,024 (GRCm39)	missense	probably benign	0.27
R3406:Rpgrip1	UTSW	14	52,382,666 (GRCm39)	missense	possibly damaging	0.92
R3835:Rpgrip1	UTSW	14	52,384,710 (GRCm39)	missense	probably damaging	1.00
R4084:Rpgrip1	UTSW	14	52,386,808 (GRCm39)	missense	possibly damaging	0.72
R4124:Rpgrip1	UTSW	14	52,389,781 (GRCm39)	splice site	probably null
R4381:Rpgrip1	UTSW	14	52,387,906 (GRCm39)	missense	possibly damaging	0.54
R4407:Rpgrip1	UTSW	14	52,384,856 (GRCm39)	missense	probably damaging	1.00
R4520:Rpgrip1	UTSW	14	52,389,746 (GRCm39)	missense	probably benign	0.08
R4904:Rpgrip1	UTSW	14	52,358,544 (GRCm39)	missense	possibly damaging	0.86
R4904:Rpgrip1	UTSW	14	52,397,586 (GRCm39)	missense	probably damaging	0.97
R5284:Rpgrip1	UTSW	14	52,386,733 (GRCm39)	missense	probably damaging	1.00
R5342:Rpgrip1	UTSW	14	52,382,666 (GRCm39)	missense	possibly damaging	0.92
R5377:Rpgrip1	UTSW	14	52,397,652 (GRCm39)	missense	possibly damaging	0.96
R5499:Rpgrip1	UTSW	14	52,378,042 (GRCm39)	missense	probably benign	0.00
R5729:Rpgrip1	UTSW	14	52,397,617 (GRCm39)	missense	probably benign	0.28
R5834:Rpgrip1	UTSW	14	52,395,839 (GRCm39)	missense	probably damaging	0.99
R6157:Rpgrip1	UTSW	14	52,349,631 (GRCm39)	missense	probably benign	0.00
R6455:Rpgrip1	UTSW	14	52,378,646 (GRCm39)	missense	probably damaging	0.97
R6796:Rpgrip1	UTSW	14	52,387,469 (GRCm39)	missense	probably damaging	1.00
R7065:Rpgrip1	UTSW	14	52,378,650 (GRCm39)	missense	possibly damaging	0.96
R7173:Rpgrip1	UTSW	14	52,349,633 (GRCm39)	missense	possibly damaging	0.59
R7302:Rpgrip1	UTSW	14	52,387,012 (GRCm39)	missense	unknown
R7315:Rpgrip1	UTSW	14	52,358,458 (GRCm39)	missense	not run
R7320:Rpgrip1	UTSW	14	52,368,673 (GRCm39)	missense	possibly damaging	0.53
R7344:Rpgrip1	UTSW	14	52,378,116 (GRCm39)	missense	probably damaging	0.98
R7459:Rpgrip1	UTSW	14	52,378,016 (GRCm39)	missense	probably benign	0.18
R7797:Rpgrip1	UTSW	14	52,371,277 (GRCm39)	missense	possibly damaging	0.53
R7852:Rpgrip1	UTSW	14	52,383,337 (GRCm39)	missense	probably benign	0.01
R7916:Rpgrip1	UTSW	14	52,368,641 (GRCm39)	missense	possibly damaging	0.53
R7990:Rpgrip1	UTSW	14	52,366,975 (GRCm39)	missense	possibly damaging	0.53
R8041:Rpgrip1	UTSW	14	52,356,702 (GRCm39)	missense	possibly damaging	0.53
R8344:Rpgrip1	UTSW	14	52,387,819 (GRCm39)	missense	possibly damaging	0.62
R8403:Rpgrip1	UTSW	14	52,389,658 (GRCm39)	critical splice acceptor site	probably null
R8559:Rpgrip1	UTSW	14	52,386,714 (GRCm39)	missense	unknown
R8679:Rpgrip1	UTSW	14	52,396,852 (GRCm39)	missense	probably damaging	1.00
R8817:Rpgrip1	UTSW	14	52,378,056 (GRCm39)	missense	probably benign	0.33
R8890:Rpgrip1	UTSW	14	52,382,501 (GRCm39)	missense	possibly damaging	0.85
R9197:Rpgrip1	UTSW	14	52,382,857 (GRCm39)	missense	possibly damaging	0.51
RF028:Rpgrip1	UTSW	14	52,386,855 (GRCm39)	nonsense	probably null
RF034:Rpgrip1	UTSW	14	52,386,983 (GRCm39)	utr 3 prime	probably benign
RF035:Rpgrip1	UTSW	14	52,386,850 (GRCm39)	utr 3 prime	probably benign
RF036:Rpgrip1	UTSW	14	52,386,998 (GRCm39)	frame shift	probably null
RF040:Rpgrip1	UTSW	14	52,386,994 (GRCm39)	frame shift	probably null
RF043:Rpgrip1	UTSW	14	52,386,852 (GRCm39)	utr 3 prime	probably benign
X0024:Rpgrip1	UTSW	14	52,378,665 (GRCm39)	missense	possibly damaging	0.85
X0026:Rpgrip1	UTSW	14	52,384,678 (GRCm39)	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- AGCAACGCGCTTCCTTCCTATG -3'
(R):5'- CGCTGTTAGTCACATGACATCACCC -3'

Sequencing Primer
(F):5'- GGCAAGTGCCAAACTTCTG -3'
(R):5'- TCACATGACATCACCCAAGATGG -3'

Posted On

2013-10-16