Incidental Mutation 'RF040:Rpgrip1'
Institutional Source Beutler Lab
Gene Symbol Rpgrip1
Ensembl Gene ENSMUSG00000057132
Gene Nameretinitis pigmentosa GTPase regulator interacting protein 1
SynonymsA930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #RF040 (G1)
Quality Score153.249
Status Not validated
Chromosomal Location52110704-52163546 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGGAAGAGG to AG at 52149537 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181017] [ENSMUST00000181401]
Predicted Effect probably null
Transcript: ENSMUST00000111600
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132

low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000111603
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132

low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180500
Predicted Effect probably benign
Transcript: ENSMUST00000180513
Predicted Effect probably benign
Transcript: ENSMUST00000180646
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000181017
SMART Domains Protein: ENSMUSP00000137900
Gene: ENSMUSG00000057132

coiled coil region 1 31 N/A INTRINSIC
Blast:C2 126 254 2e-41 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000181401
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132

low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181627
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik TG TGTCAGGGCAGCAGCAG 8: 84,167,575 probably benign Het
A030005L19Rik TGCTGTG TGCTGTGACAGCTGTG 1: 82,913,577 probably benign Het
A030005L19Rik G GTGGCTGCTC 1: 82,913,590 probably benign Het
Cacna1f CTGAATTGGTTCCCAGACCCGTGT CT X: 7,618,971 probably null Het
Calhm1 C CTGTGGCTGTGGA 19: 47,141,277 probably benign Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dnajc2 TAGTTG T 5: 21,757,697 probably null Het
Fam71e1 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA 7: 44,500,521 probably null Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Gab3 CTT CTTTTT X: 75,000,027 probably benign Het
Gykl1 G A 18: 52,694,416 R232Q probably benign Het
Heatr3 TAT TATTGAT 8: 88,156,457 probably benign Het
Kmt2e TTT TTTTCTT 5: 23,478,509 probably benign Het
Luzp1 A AGGTGGCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 AACA AACAACA X: 71,118,814 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Med12l AGC AGCCGC 3: 59,275,967 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,705 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 AGCAGCAGC AGCAGCAGCCGCAGCAGC 19: 46,081,363 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Olfr625-ps1 ACTTGCTGATATCTT ACTT 7: 103,682,938 probably null Het
Osmr TTCT TTCTTCT 15: 6,837,701 probably benign Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pdik1l AC ACCACCGC 4: 134,279,515 probably benign Het
Rragd CATGCCTTTCATTCTA C 4: 32,995,150 probably benign Het
Ryr3 CTGA C 2: 112,910,524 probably benign Het
Sh3pxd2b CCTGTG CCTGTGTCTGTG 11: 32,423,055 probably benign Het
Smarca2 GC GCCCCACC 19: 26,631,022 probably benign Het
Sprr2b CAGTATGCTGTGAGCCTTGTCCTCCT C 3: 92,317,564 probably null Het
Sry GCTG GCTGGTGGTGGTGGTCATGGAACTG Y: 2,662,590 probably benign Het
Tcof1 CT CTATT 18: 60,828,408 probably benign Het
Tfeb GCA GCAACA 17: 47,786,097 probably benign Het
Tfeb CAG CAGGAG 17: 47,786,110 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCATCA 17: 47,786,112 probably benign Het
Tgoln1 T TCACCTCCCGTGGTCTTGCCAGAAG 6: 72,616,074 probably benign Het
Tmem59 TTTGTTT TTTGTTTGGTTGTTT 4: 107,190,526 probably benign Het
Triobp CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA 15: 78,967,063 probably benign Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Zfhx3 CAGCA CAGCAACAGGAGCA 8: 108,956,101 probably benign Het
Other mutations in Rpgrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Rpgrip1 APN 14 52150438 splice site probably null
IGL01016:Rpgrip1 APN 14 52145836 missense probably damaging 1.00
IGL01019:Rpgrip1 APN 14 52131176 missense possibly damaging 0.70
IGL01382:Rpgrip1 APN 14 52145477 missense possibly damaging 0.93
IGL01433:Rpgrip1 APN 14 52126377 missense probably damaging 1.00
IGL01528:Rpgrip1 APN 14 52112177 nonsense probably null
IGL01548:Rpgrip1 APN 14 52126271 splice site probably benign
IGL01652:Rpgrip1 APN 14 52145492 unclassified probably benign
IGL02040:Rpgrip1 APN 14 52121019 missense possibly damaging 0.86
IGL02113:Rpgrip1 APN 14 52133844 missense possibly damaging 0.85
IGL02121:Rpgrip1 APN 14 52147374 missense possibly damaging 0.89
IGL02185:Rpgrip1 APN 14 52112228 missense possibly damaging 0.72
IGL02234:Rpgrip1 APN 14 52131309 splice site probably benign
IGL02322:Rpgrip1 APN 14 52150042 missense possibly damaging 0.89
IGL02379:Rpgrip1 APN 14 52138888 missense possibly damaging 0.53
IGL02524:Rpgrip1 APN 14 52121054 missense probably benign 0.01
IGL02836:Rpgrip1 APN 14 52145257 splice site probably null
IGL03264:Rpgrip1 APN 14 52140652 missense possibly damaging 0.53
IGL03410:Rpgrip1 APN 14 52158366 unclassified probably benign
FR4976:Rpgrip1 UTSW 14 52149394 utr 3 prime probably benign
FR4976:Rpgrip1 UTSW 14 52149544 utr 3 prime probably benign
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0089:Rpgrip1 UTSW 14 52149384 utr 3 prime probably benign
R0498:Rpgrip1 UTSW 14 52131314 splice site probably benign
R0602:Rpgrip1 UTSW 14 52133856 missense possibly damaging 0.72
R0776:Rpgrip1 UTSW 14 52141169 missense possibly damaging 0.85
R1139:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
R1528:Rpgrip1 UTSW 14 52112224 missense probably benign 0.01
R1715:Rpgrip1 UTSW 14 52140691 missense possibly damaging 0.53
R1934:Rpgrip1 UTSW 14 52114644 missense possibly damaging 0.53
R2087:Rpgrip1 UTSW 14 52136622 splice site probably null
R2114:Rpgrip1 UTSW 14 52149567 missense probably benign 0.27
R3406:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R3835:Rpgrip1 UTSW 14 52147253 missense probably damaging 1.00
R4084:Rpgrip1 UTSW 14 52149351 missense possibly damaging 0.72
R4124:Rpgrip1 UTSW 14 52152324 splice site probably null
R4381:Rpgrip1 UTSW 14 52150449 missense possibly damaging 0.54
R4407:Rpgrip1 UTSW 14 52147399 missense probably damaging 1.00
R4520:Rpgrip1 UTSW 14 52152289 missense probably benign 0.08
R4904:Rpgrip1 UTSW 14 52121087 missense possibly damaging 0.86
R4904:Rpgrip1 UTSW 14 52160129 missense probably damaging 0.97
R5284:Rpgrip1 UTSW 14 52149276 missense probably damaging 1.00
R5342:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R5377:Rpgrip1 UTSW 14 52160195 missense possibly damaging 0.96
R5499:Rpgrip1 UTSW 14 52140585 missense probably benign 0.00
R5729:Rpgrip1 UTSW 14 52160160 missense probably benign 0.28
R5834:Rpgrip1 UTSW 14 52158382 missense probably damaging 0.99
R6157:Rpgrip1 UTSW 14 52112174 missense probably benign 0.00
R6455:Rpgrip1 UTSW 14 52141189 missense probably damaging 0.97
R6796:Rpgrip1 UTSW 14 52150012 missense probably damaging 1.00
R7065:Rpgrip1 UTSW 14 52141193 missense possibly damaging 0.96
R7173:Rpgrip1 UTSW 14 52112176 missense possibly damaging 0.59
R7302:Rpgrip1 UTSW 14 52149555 missense unknown
R7315:Rpgrip1 UTSW 14 52121001 missense not run
R7320:Rpgrip1 UTSW 14 52131216 missense possibly damaging 0.53
R7344:Rpgrip1 UTSW 14 52140659 missense probably damaging 0.98
R7459:Rpgrip1 UTSW 14 52140559 missense probably benign 0.18
R7797:Rpgrip1 UTSW 14 52133820 missense possibly damaging 0.53
R7852:Rpgrip1 UTSW 14 52145880 missense probably benign 0.01
R7916:Rpgrip1 UTSW 14 52131184 missense possibly damaging 0.53
R7990:Rpgrip1 UTSW 14 52129518 missense possibly damaging 0.53
R8041:Rpgrip1 UTSW 14 52119245 missense possibly damaging 0.53
R8344:Rpgrip1 UTSW 14 52150362 missense possibly damaging 0.62
R8403:Rpgrip1 UTSW 14 52152201 critical splice acceptor site probably null
R8559:Rpgrip1 UTSW 14 52149257 missense unknown
R8679:Rpgrip1 UTSW 14 52159395 missense probably damaging 1.00
R8817:Rpgrip1 UTSW 14 52140599 missense probably benign 0.33
R8890:Rpgrip1 UTSW 14 52145044 missense possibly damaging 0.85
RF028:Rpgrip1 UTSW 14 52149398 nonsense probably null
RF034:Rpgrip1 UTSW 14 52149526 utr 3 prime probably benign
RF035:Rpgrip1 UTSW 14 52149393 utr 3 prime probably benign
RF036:Rpgrip1 UTSW 14 52149541 frame shift probably null
RF043:Rpgrip1 UTSW 14 52149395 utr 3 prime probably benign
X0024:Rpgrip1 UTSW 14 52141208 missense possibly damaging 0.85
X0026:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04