Incidental Mutation 'R0882:Olfr586'
ID80639
Institutional Source Beutler Lab
Gene Symbol Olfr586
Ensembl Gene ENSMUSG00000066268
Gene Nameolfactory receptor 586
SynonymsMOR8-7, GA_x6K02T2PBJ9-5836380-5835439, MOR8-2
MMRRC Submission 039049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R0882 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103118403-103125638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 103122575 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 66 (S66A)
Ref Sequence ENSEMBL: ENSMUSP00000149226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084811] [ENSMUST00000211075] [ENSMUST00000213281] [ENSMUST00000215304]
Predicted Effect probably benign
Transcript: ENSMUST00000084811
AA Change: S70A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000081872
Gene: ENSMUSG00000066268
AA Change: S70A

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 6.1e-111 PFAM
Pfam:7TM_GPCR_Srsx 41 312 1.6e-11 PFAM
Pfam:7tm_1 47 297 1.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211075
AA Change: S66A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000213281
AA Change: S66A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000215304
AA Change: S66A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Adh1 A T 3: 138,286,797 I225F possibly damaging Het
Agap2 A G 10: 127,087,450 K691E unknown Het
Alcam T C 16: 52,253,210 D564G possibly damaging Het
Apbb2 T A 5: 66,400,255 T289S probably damaging Het
BC005561 T C 5: 104,519,009 S466P probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep68 T C 11: 20,239,393 I540V probably benign Het
Ctla4 T C 1: 60,909,238 V23A probably benign Het
Dnah7b T A 1: 46,340,132 D3675E probably benign Het
Fam209 G T 2: 172,472,635 V15F probably benign Het
Fat3 A G 9: 16,031,368 V1236A possibly damaging Het
Gabbr2 A G 4: 46,718,904 I38T probably damaging Het
Gdpd4 T C 7: 97,966,298 I110T probably damaging Het
Gm4841 C T 18: 60,269,780 A414T possibly damaging Het
Gtf3c4 A T 2: 28,834,770 Y176N probably damaging Het
Hist2h2bb G A 3: 96,269,744 probably null Het
Igsf9b T C 9: 27,319,316 Y264H probably damaging Het
Itih4 A T 14: 30,892,274 N394Y probably damaging Het
Kmt2c T C 5: 25,295,607 T3815A possibly damaging Het
Lrwd1 T C 5: 136,123,400 probably null Het
Mc3r A G 2: 172,249,791 K311R probably benign Het
Myb T C 10: 21,156,360 T41A possibly damaging Het
Nfix T C 8: 84,727,925 D201G probably damaging Het
Nos1 T C 5: 117,947,447 V1280A probably damaging Het
Olfr160 T C 9: 37,711,872 M136V probably benign Het
Pcdh15 A G 10: 74,342,656 T582A probably damaging Het
Pcdhb12 C A 18: 37,437,322 A507E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pkp2 C A 16: 16,269,711 A753E probably damaging Het
Plekha3 G A 2: 76,682,798 V76I possibly damaging Het
Pnpla6 T C 8: 3,517,081 L33P probably damaging Het
Pot1b C T 17: 55,666,400 probably benign Het
Prr5l T C 2: 101,758,541 E88G possibly damaging Het
Prss57 G A 10: 79,785,865 H97Y probably damaging Het
Rttn C T 18: 88,973,689 Q131* probably null Het
Scaf11 G T 15: 96,418,295 S1129R possibly damaging Het
Slc25a20 T A 9: 108,681,990 M185K possibly damaging Het
Sorbs3 T A 14: 70,207,572 E19V probably damaging Het
Srgap2 A T 1: 131,289,515 C1020S probably benign Het
Tmem109 T C 19: 10,871,841 R217G possibly damaging Het
Trio A T 15: 27,732,894 I2967N probably damaging Het
Vars2 T C 17: 35,657,299 E899G probably benign Het
Vmn2r109 A G 17: 20,554,580 probably benign Het
Vps53 A G 11: 76,082,659 F170L probably damaging Het
Zc2hc1a G A 3: 7,526,362 S149N possibly damaging Het
Zfp820 A G 17: 21,823,836 probably benign Het
Zhx3 A C 2: 160,780,709 F513V probably damaging Het
Other mutations in Olfr586
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Olfr586 APN 7 103121820 utr 3 prime probably benign
R0502:Olfr586 UTSW 7 103122436 missense possibly damaging 0.94
R0503:Olfr586 UTSW 7 103122436 missense possibly damaging 0.94
R0508:Olfr586 UTSW 7 103121986 missense possibly damaging 0.93
R0962:Olfr586 UTSW 7 103122010 missense possibly damaging 0.50
R1112:Olfr586 UTSW 7 103122404 missense probably damaging 1.00
R2226:Olfr586 UTSW 7 103121908 missense probably benign 0.06
R4285:Olfr586 UTSW 7 103122660 nonsense probably null
R5817:Olfr586 UTSW 7 103121908 missense possibly damaging 0.94
R6342:Olfr586 UTSW 7 103122356 missense probably damaging 0.99
R6380:Olfr586 UTSW 7 103121929 missense probably benign 0.02
R6565:Olfr586 UTSW 7 103122238 missense probably damaging 0.99
R7861:Olfr586 UTSW 7 103122692 missense probably benign 0.03
RF020:Olfr586 UTSW 7 103121891 missense probably benign 0.05
Z1177:Olfr586 UTSW 7 103122391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAAGCCCGATTTGAAGGACCC -3'
(R):5'- GGAGCCATCCATCTTGATTCCATGC -3'

Sequencing Primer
(F):5'- ATTTGAAGGACCCTGGCACTG -3'
(R):5'- CATCTTGATTCCATGCATACTGG -3'
Posted On2013-11-07