Incidental Mutation 'R0864:Trim43c'
ID82254
Institutional Source Beutler Lab
Gene Symbol Trim43c
Ensembl Gene ENSMUSG00000067399
Gene Nametripartite motif-containing 43C
SynonymsTrim43
MMRRC Submission 039038-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0864 (G1)
Quality Score200
Status Validated
Chromosome9
Chromosomal Location88839164-88848190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88843034 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 202 (H202L)
Ref Sequence ENSEMBL: ENSMUSP00000139715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163255] [ENSMUST00000186363]
Predicted Effect probably benign
Transcript: ENSMUST00000163255
AA Change: H203L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129255
Gene: ENSMUSG00000067399
AA Change: H203L

DomainStartEndE-ValueType
RING 16 56 3.34e-6 SMART
PDB:2IWG|E 329 446 3e-15 PDB
Blast:SPRY 336 441 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180783
Predicted Effect probably benign
Transcript: ENSMUST00000186363
AA Change: H202L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139715
Gene: ENSMUSG00000067399
AA Change: H202L

DomainStartEndE-ValueType
RING 16 56 1.6e-8 SMART
SPRY 334 445 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188156
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 93.8%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,894,786 probably benign Het
Alx4 A G 2: 93,642,855 Y66C probably damaging Het
Apol7e T A 15: 77,717,793 V197E probably damaging Het
Chac1 C A 2: 119,353,469 A184E probably damaging Het
Clmn G A 12: 104,790,015 T192I possibly damaging Het
Csmd1 T A 8: 16,190,026 Y1124F probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
D430041D05Rik G A 2: 104,230,428 P1374S possibly damaging Het
Dyrk4 T C 6: 126,877,333 E499G possibly damaging Het
Fat1 T A 8: 45,018,037 I1603N probably damaging Het
Fbn1 A T 2: 125,342,891 C1660* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Hpn T C 7: 31,109,001 I41V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Map4 A G 9: 109,978,969 Y34C probably damaging Het
Mapk8 C T 14: 33,392,992 R189H probably damaging Het
Mprip T C 11: 59,758,761 V1097A probably benign Het
Msh2 A G 17: 87,680,052 T207A probably benign Het
Muc4 A G 16: 32,752,002 S627G probably benign Het
Nbeal2 G A 9: 110,628,195 T2266I probably damaging Het
Pdcd6ip A T 9: 113,674,510 probably benign Het
Pdk2 A G 11: 95,027,933 Y339H probably damaging Het
Piwil2 T C 14: 70,395,374 D583G probably benign Het
Plin4 T A 17: 56,103,966 M1022L probably benign Het
Pmpca G A 2: 26,393,209 probably null Het
Rbbp4 G T 4: 129,320,551 probably benign Het
Rbbp8 G A 18: 11,732,184 probably benign Het
Rbms3 A T 9: 117,629,792 probably benign Het
Snx14 A T 9: 88,383,996 S726T possibly damaging Het
Supt4a T A 11: 87,743,087 S88T probably benign Het
Tmem245 G T 4: 56,890,837 H321Q probably damaging Het
Trip12 A G 1: 84,744,009 F1334S probably damaging Het
Vmn1r36 T C 6: 66,716,856 T12A probably null Het
Ywhae T G 11: 75,759,430 probably null Het
Zc3h4 T A 7: 16,420,179 S131T probably damaging Het
Zfp280b C T 10: 76,038,305 T6M probably benign Het
Other mutations in Trim43c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trim43c APN 9 88841856 missense probably benign 0.20
IGL02414:Trim43c APN 9 88841832 critical splice acceptor site probably null
R0054:Trim43c UTSW 9 88847515 missense probably damaging 1.00
R0765:Trim43c UTSW 9 88841916 missense probably benign 0.28
R0862:Trim43c UTSW 9 88843034 missense probably benign 0.01
R1117:Trim43c UTSW 9 88844977 missense probably benign 0.20
R1222:Trim43c UTSW 9 88843078 missense possibly damaging 0.70
R1643:Trim43c UTSW 9 88847477 missense probably damaging 0.97
R1691:Trim43c UTSW 9 88840699 missense probably damaging 0.98
R1914:Trim43c UTSW 9 88840617 missense probably benign 0.01
R3718:Trim43c UTSW 9 88844977 missense probably benign 0.20
R3772:Trim43c UTSW 9 88847757 missense probably damaging 1.00
R3852:Trim43c UTSW 9 88840401 missense probably damaging 1.00
R4774:Trim43c UTSW 9 88847652 missense possibly damaging 0.48
R5784:Trim43c UTSW 9 88847643 missense probably benign 0.03
R5833:Trim43c UTSW 9 88843037 missense possibly damaging 0.74
R6177:Trim43c UTSW 9 88840547 missense possibly damaging 0.50
R6407:Trim43c UTSW 9 88840414 missense probably benign
R6490:Trim43c UTSW 9 88844950 missense possibly damaging 0.50
R6892:Trim43c UTSW 9 88844924 missense probably benign 0.35
R8050:Trim43c UTSW 9 88840337 missense probably damaging 0.99
Z1088:Trim43c UTSW 9 88842935 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGTGTGTGCAGCACTCTGATG -3'
(R):5'- AAAAGCCACAGGTGTGGTCCTC -3'

Sequencing Primer
(F):5'- AGCACTCTGATGGGCTCC -3'
(R):5'- GTGGTCCTCAGATAATGAAGCTC -3'
Posted On2013-11-08