Incidental Mutation 'R0864:Zfp280b'
ID82259
Institutional Source Beutler Lab
Gene Symbol Zfp280b
Ensembl Gene ENSMUSG00000049764
Gene Namezinc finger protein 280B
SynonymsSuhw2, D10Jhu82e
MMRRC Submission 039038-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R0864 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76032650-76043234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76038305 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 6 (T6M)
Ref Sequence ENSEMBL: ENSMUSP00000056340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061617] [ENSMUST00000218627]
Predicted Effect probably benign
Transcript: ENSMUST00000061617
AA Change: T6M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056340
Gene: ENSMUSG00000049764
AA Change: T6M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 29 37 N/A INTRINSIC
Pfam:DUF4195 53 227 1.3e-38 PFAM
ZnF_C2H2 297 318 3.65e1 SMART
ZnF_C2H2 334 357 9.46e0 SMART
ZnF_C2H2 364 387 8.22e-2 SMART
ZnF_C2H2 394 417 4.23e0 SMART
ZnF_C2H2 423 445 1.72e1 SMART
ZnF_C2H2 451 474 2.12e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000218627
AA Change: T6M
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 93.8%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that upregulates expression of MDM2, which negatively regulates p53 expression. This gene is highly expressed in prostate cancer cells, which leads to a reduction in p53 levels and an increase in growth of the cancer cells. Several transcript variants have been found for this gene, but only one of them is protein-coding. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a A G 2: 48,894,786 probably benign Het
Alx4 A G 2: 93,642,855 Y66C probably damaging Het
Apol7e T A 15: 77,717,793 V197E probably damaging Het
Chac1 C A 2: 119,353,469 A184E probably damaging Het
Clmn G A 12: 104,790,015 T192I possibly damaging Het
Csmd1 T A 8: 16,190,026 Y1124F probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
D430041D05Rik G A 2: 104,230,428 P1374S possibly damaging Het
Dyrk4 T C 6: 126,877,333 E499G possibly damaging Het
Fat1 T A 8: 45,018,037 I1603N probably damaging Het
Fbn1 A T 2: 125,342,891 C1660* probably null Het
Gapt G C 13: 110,353,739 T130R probably damaging Het
Hpn T C 7: 31,109,001 I41V probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Map4 A G 9: 109,978,969 Y34C probably damaging Het
Mapk8 C T 14: 33,392,992 R189H probably damaging Het
Mprip T C 11: 59,758,761 V1097A probably benign Het
Msh2 A G 17: 87,680,052 T207A probably benign Het
Muc4 A G 16: 32,752,002 S627G probably benign Het
Nbeal2 G A 9: 110,628,195 T2266I probably damaging Het
Pdcd6ip A T 9: 113,674,510 probably benign Het
Pdk2 A G 11: 95,027,933 Y339H probably damaging Het
Piwil2 T C 14: 70,395,374 D583G probably benign Het
Plin4 T A 17: 56,103,966 M1022L probably benign Het
Pmpca G A 2: 26,393,209 probably null Het
Rbbp4 G T 4: 129,320,551 probably benign Het
Rbbp8 G A 18: 11,732,184 probably benign Het
Rbms3 A T 9: 117,629,792 probably benign Het
Snx14 A T 9: 88,383,996 S726T possibly damaging Het
Supt4a T A 11: 87,743,087 S88T probably benign Het
Tmem245 G T 4: 56,890,837 H321Q probably damaging Het
Trim43c A T 9: 88,843,034 H202L probably benign Het
Trip12 A G 1: 84,744,009 F1334S probably damaging Het
Vmn1r36 T C 6: 66,716,856 T12A probably null Het
Ywhae T G 11: 75,759,430 probably null Het
Zc3h4 T A 7: 16,420,179 S131T probably damaging Het
Other mutations in Zfp280b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp280b APN 10 76039663 missense probably damaging 0.99
IGL02016:Zfp280b APN 10 76039111 missense possibly damaging 0.68
IGL02245:Zfp280b APN 10 76039363 missense probably benign
IGL03233:Zfp280b APN 10 76039769 missense probably damaging 1.00
R1501:Zfp280b UTSW 10 76039769 missense probably damaging 1.00
R1643:Zfp280b UTSW 10 76039610 missense probably damaging 1.00
R2004:Zfp280b UTSW 10 76038536 missense probably benign 0.00
R2024:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2025:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2027:Zfp280b UTSW 10 76038494 missense probably damaging 1.00
R2064:Zfp280b UTSW 10 76039183 missense probably damaging 1.00
R3729:Zfp280b UTSW 10 76039102 missense probably benign 0.33
R4634:Zfp280b UTSW 10 76038829 missense probably benign 0.00
R4812:Zfp280b UTSW 10 76039090 missense probably benign 0.24
R4968:Zfp280b UTSW 10 76039354 missense probably damaging 1.00
R5007:Zfp280b UTSW 10 76039214 missense probably damaging 1.00
R5123:Zfp280b UTSW 10 76039349 missense probably benign 0.02
R5503:Zfp280b UTSW 10 76039462 unclassified probably null
R5552:Zfp280b UTSW 10 76039663 nonsense probably null
R6954:Zfp280b UTSW 10 76039688 missense probably benign 0.36
R7299:Zfp280b UTSW 10 76038703 missense probably damaging 0.98
R7301:Zfp280b UTSW 10 76038703 missense probably damaging 0.98
R7485:Zfp280b UTSW 10 76039241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTATCTCAAAGGCTGCTTGGC -3'
(R):5'- TTTTAACCGTGAACCTGGGGTGAC -3'

Sequencing Primer
(F):5'- ACAGCTTGTCGATGCACC -3'
(R):5'- AACCTGGGGTGACTCTGTTC -3'
Posted On2013-11-08