Incidental Mutation 'R0850:Fbxw25'
ID 82523
Institutional Source Beutler Lab
Gene Symbol Fbxw25
Ensembl Gene ENSMUSG00000094992
Gene Name F-box and WD-40 domain protein 25
Synonyms E330001B16Rik
MMRRC Submission 039029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R0850 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 109645122-109664652 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109649617 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 425 (K425R)
Ref Sequence ENSEMBL: ENSMUSP00000128652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163839]
AlphaFold F7C9P2
Predicted Effect probably benign
Transcript: ENSMUST00000163839
AA Change: K425R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128652
Gene: ENSMUSG00000094992
AA Change: K425R

DomainStartEndE-ValueType
FBOX 5 45 5.44e-6 SMART
SCOP:d1gxra_ 119 228 1e-6 SMART
Blast:WD40 137 176 6e-6 BLAST
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016C15Rik A G 1: 177,741,005 T23A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
9330182L06Rik T A 5: 9,417,993 N220K probably damaging Het
Agbl3 T A 6: 34,799,204 F210Y probably damaging Het
Dgkq A G 5: 108,654,578 V418A possibly damaging Het
Dmp1 A T 5: 104,212,787 D443V possibly damaging Het
Elavl3 T G 9: 22,036,763 D35A probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gm5538 T G 3: 59,752,248 I374R possibly damaging Het
Gypa A G 8: 80,496,345 H26R unknown Het
H2-DMb1 T C 17: 34,155,562 V62A probably benign Het
Helb T C 10: 120,105,367 H472R probably damaging Het
Herc1 T G 9: 66,466,670 V3197G probably damaging Het
Herc2 C A 7: 56,204,483 N3712K probably benign Het
Herc6 T C 6: 57,583,242 V89A possibly damaging Het
Hspa1l A G 17: 34,977,623 T213A probably benign Het
Kcna7 T C 7: 45,409,431 S381P probably damaging Het
Kif19a C A 11: 114,780,787 P164Q probably damaging Het
Macf1 A G 4: 123,474,402 S2189P probably benign Het
Mpo A G 11: 87,797,502 N329S probably damaging Het
Mrps15 A G 4: 126,048,686 Y76C probably damaging Het
Olfr643 T A 7: 104,059,045 M186L probably benign Het
Olfr790 T C 10: 129,501,724 V280A probably damaging Het
Prdm2 T C 4: 143,132,203 R1506G possibly damaging Het
Ptprb A T 10: 116,302,125 Q311H possibly damaging Het
Ptprb T C 10: 116,339,510 Y1137H probably damaging Het
Scaf8 A G 17: 3,195,774 probably null Het
Slc25a1 A T 16: 17,927,281 F105Y probably benign Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Tmed10 A G 12: 85,343,505 F195L probably benign Het
Tmem45a2 T A 16: 57,045,369 I151F probably benign Het
Vmn2r93 C A 17: 18,305,017 F312L possibly damaging Het
Zfp326 A G 5: 105,878,797 probably null Het
Other mutations in Fbxw25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03330:Fbxw25 APN 9 109645239 missense probably benign 0.00
goodtimes UTSW 9 109663374 critical splice donor site probably null
shakeys UTSW 9 109654583 missense
R0158:Fbxw25 UTSW 9 109654652 missense possibly damaging 0.74
R1109:Fbxw25 UTSW 9 109650060 missense probably benign 0.00
R1386:Fbxw25 UTSW 9 109654641 missense possibly damaging 0.77
R1609:Fbxw25 UTSW 9 109663510 missense probably benign 0.11
R1750:Fbxw25 UTSW 9 109650073 missense probably benign 0.23
R1977:Fbxw25 UTSW 9 109652856 missense possibly damaging 0.72
R2427:Fbxw25 UTSW 9 109652860 missense probably benign 0.09
R3841:Fbxw25 UTSW 9 109662134 nonsense probably null
R4356:Fbxw25 UTSW 9 109662085 missense probably damaging 1.00
R4934:Fbxw25 UTSW 9 109651637 missense possibly damaging 0.63
R5024:Fbxw25 UTSW 9 109663374 critical splice donor site probably null
R5175:Fbxw25 UTSW 9 109664563 missense probably damaging 1.00
R5323:Fbxw25 UTSW 9 109663505 missense probably benign 0.04
R5389:Fbxw25 UTSW 9 109652886 missense possibly damaging 0.95
R5493:Fbxw25 UTSW 9 109652916 missense probably benign 0.01
R6268:Fbxw25 UTSW 9 109654650 missense probably damaging 1.00
R6739:Fbxw25 UTSW 9 109651631 missense probably benign 0.29
R7275:Fbxw25 UTSW 9 109654592 missense
R7492:Fbxw25 UTSW 9 109664530 critical splice donor site probably null
R7623:Fbxw25 UTSW 9 109654583 missense
R7784:Fbxw25 UTSW 9 109650119 missense
R7861:Fbxw25 UTSW 9 109664557 nonsense probably null
R7887:Fbxw25 UTSW 9 109649594 critical splice donor site probably null
R8973:Fbxw25 UTSW 9 109650064 missense
X0023:Fbxw25 UTSW 9 109651775 missense possibly damaging 0.94
Z1176:Fbxw25 UTSW 9 109651738 missense
Predicted Primers PCR Primer
(F):5'- TGTGCTGAGATCCCAAGAACTAGCAA -3'
(R):5'- GTCTGACATTGACTCCAGCCTACTAACA -3'

Sequencing Primer
(F):5'- ggagtgggtgggttggg -3'
(R):5'- TCGTCACCTGTAACAATGGC -3'
Posted On 2013-11-08