Incidental Mutation 'R1084:Rab6b'
ID84960
Institutional Source Beutler Lab
Gene Symbol Rab6b
Ensembl Gene ENSMUSG00000032549
Gene NameRAB6B, member RAS oncogene family
SynonymsC330006L04Rik, D9Bwg0185e
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103111787-103185276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103162635 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 128 (T128M)
Ref Sequence ENSEMBL: ENSMUSP00000035155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035155] [ENSMUST00000189134]
Predicted Effect probably damaging
Transcript: ENSMUST00000035155
AA Change: T128M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035155
Gene: ENSMUSG00000032549
AA Change: T128M

DomainStartEndE-ValueType
RAB 14 177 5.19e-86 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189134
AA Change: T74M

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.2906 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in growth retardation and multiple behavioral and immunological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Scel G T 14: 103,564,843 probably null Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Rab6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rab6b APN 9 103163895 missense probably benign 0.26
IGL01543:Rab6b APN 9 103162638 missense probably damaging 1.00
IGL02708:Rab6b APN 9 103160875 critical splice donor site probably null
R0139:Rab6b UTSW 9 103140377 splice site probably null
R1034:Rab6b UTSW 9 103167124 missense probably benign 0.10
R3721:Rab6b UTSW 9 103167174 critical splice donor site probably null
R4591:Rab6b UTSW 9 103167174 critical splice donor site probably null
R5095:Rab6b UTSW 9 103140384 missense probably damaging 1.00
R5725:Rab6b UTSW 9 103163862 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGAGGCCATCTTTCCTTCTGACC -3'
(R):5'- TGTCAACGCCAGGATTTCCCAG -3'

Sequencing Primer
(F):5'- TCCTTCTGACCCCTCCG -3'
(R):5'- CCTTTGCTGAGCTGAGGAAAATC -3'
Posted On2013-11-18