Incidental Mutation 'R1084:Scel'
ID84970
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Namesciellin
Synonyms9230114I02Rik
MMRRC Submission 039170-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1084 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103513342-103612797 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 103564843 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
Predicted Effect probably null
Transcript: ENSMUST00000095576
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000227322
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T A 15: 60,918,155 probably benign Het
Abcg4 C T 9: 44,277,469 V476M probably benign Het
Arhgap9 A G 10: 127,327,928 S478G probably damaging Het
Blvra A G 2: 127,080,653 T3A probably benign Het
Crygb C T 1: 65,080,495 D109N possibly damaging Het
Cyp3a59 A T 5: 146,096,674 T207S probably benign Het
Cyp4b1 A G 4: 115,640,312 V163A probably benign Het
Dmxl2 A T 9: 54,416,433 S1222R probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 G A 15: 28,343,452 V2333I probably benign Het
Eral1 C T 11: 78,074,498 V364M probably damaging Het
Fat4 T C 3: 38,979,825 V2542A possibly damaging Het
Glcci1 C T 6: 8,573,221 Q50* probably null Het
Heg1 A G 16: 33,706,997 D109G probably benign Het
Lama1 C A 17: 67,804,469 S2238R probably benign Het
Ltbp1 G A 17: 75,359,425 W1053* probably null Het
Ly6f T C 15: 75,268,773 L15P probably damaging Het
Mapk8 T A 14: 33,388,803 K290* probably null Het
Mbd1 A G 18: 74,269,532 Y35C probably damaging Het
Mcf2l T C 8: 13,002,645 V503A possibly damaging Het
Morc2a A G 11: 3,650,454 probably benign Het
Ms4a8a T A 19: 11,076,362 I127F probably damaging Het
Myo1d T C 11: 80,684,395 Y165C probably damaging Het
Ocel1 G T 8: 71,371,988 probably null Het
Plekhh2 C T 17: 84,571,126 T603M probably damaging Het
Rab6b C T 9: 103,162,635 T128M probably damaging Het
Sec23a A T 12: 58,985,135 N436K probably damaging Het
Sec24a A G 11: 51,713,581 L736P probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Sulf1 AAGGGA AAGGGAGGGA 1: 12,836,164 probably null Het
Tex15 A G 8: 33,577,004 E2154G probably benign Het
Tnrc18 A G 5: 142,764,767 probably null Het
Tpr A G 1: 150,442,161 Q2140R probably benign Het
Zfp142 T C 1: 74,571,826 R834G probably benign Het
Zfp276 G A 8: 123,254,723 R3Q probably damaging Het
Zscan4d A T 7: 11,165,005 L115Q probably damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGCCTGTGTGTACCATAGACTCTCC -3'
(R):5'- AGTGGTTGAGATCTGAGGTCACGAG -3'

Sequencing Primer
(F):5'- GTGTGTACCATAGACTCTCCTATCC -3'
(R):5'- GGCCATCCATCCATGTCAG -3'
Posted On2013-11-18