Mutagenetix > Incidental Mutations

Incidental Mutation 'R1084:Scel'

84970

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

039170-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1084 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 103564843 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

Predicted Effect

probably null
Transcript: ENSMUST00000095576

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000227322

Meta Mutation Damage Score

0.9484

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.3%
20x: 93.7%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	A	15: 60,918,155		probably benign	Het
Abcg4	C	T	9: 44,277,469	V476M	probably benign	Het
Arhgap9	A	G	10: 127,327,928	S478G	probably damaging	Het
Blvra	A	G	2: 127,080,653	T3A	probably benign	Het
Crygb	C	T	1: 65,080,495	D109N	possibly damaging	Het
Cyp3a59	A	T	5: 146,096,674	T207S	probably benign	Het
Cyp4b1	A	G	4: 115,640,312	V163A	probably benign	Het
Dmxl2	A	T	9: 54,416,433	S1222R	probably damaging	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	G	A	15: 28,343,452	V2333I	probably benign	Het
Eral1	C	T	11: 78,074,498	V364M	probably damaging	Het
Fat4	T	C	3: 38,979,825	V2542A	possibly damaging	Het
Glcci1	C	T	6: 8,573,221	Q50*	probably null	Het
Heg1	A	G	16: 33,706,997	D109G	probably benign	Het
Lama1	C	A	17: 67,804,469	S2238R	probably benign	Het
Ltbp1	G	A	17: 75,359,425	W1053*	probably null	Het
Ly6f	T	C	15: 75,268,773	L15P	probably damaging	Het
Mapk8	T	A	14: 33,388,803	K290*	probably null	Het
Mbd1	A	G	18: 74,269,532	Y35C	probably damaging	Het
Mcf2l	T	C	8: 13,002,645	V503A	possibly damaging	Het
Morc2a	A	G	11: 3,650,454		probably benign	Het
Ms4a8a	T	A	19: 11,076,362	I127F	probably damaging	Het
Myo1d	T	C	11: 80,684,395	Y165C	probably damaging	Het
Ocel1	G	T	8: 71,371,988		probably null	Het
Plekhh2	C	T	17: 84,571,126	T603M	probably damaging	Het
Rab6b	C	T	9: 103,162,635	T128M	probably damaging	Het
Sec23a	A	T	12: 58,985,135	N436K	probably damaging	Het
Sec24a	A	G	11: 51,713,581	L736P	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Sulf1	AAGGGA	AAGGGAGGGA	1: 12,836,164		probably null	Het
Tex15	A	G	8: 33,577,004	E2154G	probably benign	Het
Tnrc18	A	G	5: 142,764,767		probably null	Het
Tpr	A	G	1: 150,442,161	Q2140R	probably benign	Het
Zfp142	T	C	1: 74,571,826	R834G	probably benign	Het
Zfp276	G	A	8: 123,254,723	R3Q	probably damaging	Het
Zscan4d	A	T	7: 11,165,005	L115Q	probably damaging	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TGCCTGTGTGTACCATAGACTCTCC -3'
(R):5'- AGTGGTTGAGATCTGAGGTCACGAG -3'

Sequencing Primer
(F):5'- GTGTGTACCATAGACTCTCCTATCC -3'
(R):5'- GGCCATCCATCCATGTCAG -3'

Posted On

2013-11-18