Incidental Mutation 'R1086:Rnh1'
ID85029
Institutional Source Beutler Lab
Gene Symbol Rnh1
Ensembl Gene ENSMUSG00000038650
Gene Nameribonuclease/angiogenin inhibitor 1
SynonymsRNH
MMRRC Submission 039172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1086 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141160326-141172857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 141163369 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 231 (Q231P)
Ref Sequence ENSEMBL: ENSMUSP00000147928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106033] [ENSMUST00000167493] [ENSMUST00000209378] [ENSMUST00000210314] [ENSMUST00000210979]
Predicted Effect probably benign
Transcript: ENSMUST00000106033
AA Change: Q195P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101651
Gene: ENSMUSG00000038650
AA Change: Q195P

DomainStartEndE-ValueType
Blast:LRR 22 49 3e-7 BLAST
LRR 50 77 2.95e-3 SMART
LRR 79 106 1.95e-3 SMART
LRR_RI 107 134 1.36e-7 SMART
LRR 136 163 7.15e-2 SMART
LRR 164 191 2.65e-5 SMART
LRR 193 220 4.24e-1 SMART
LRR 221 248 4.94e-5 SMART
LRR 250 277 2.34e-6 SMART
LRR 278 305 1.15e-5 SMART
LRR 307 334 8e0 SMART
LRR 335 362 4.75e-7 SMART
LRR 364 391 1.12e-3 SMART
LRR 392 419 6.17e-6 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167493
AA Change: Q195P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133061
Gene: ENSMUSG00000038650
AA Change: Q195P

DomainStartEndE-ValueType
Blast:LRR 22 49 3e-7 BLAST
LRR 50 77 2.95e-3 SMART
LRR 79 106 1.95e-3 SMART
LRR_RI 107 134 1.36e-7 SMART
LRR 136 163 7.15e-2 SMART
LRR 164 191 2.65e-5 SMART
LRR 193 220 4.24e-1 SMART
LRR 221 248 4.94e-5 SMART
LRR 250 277 2.34e-6 SMART
LRR 278 305 1.15e-5 SMART
LRR 307 334 8e0 SMART
LRR 335 362 4.75e-7 SMART
LRR 364 391 1.12e-3 SMART
LRR 392 419 6.17e-6 SMART
low complexity region 437 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209378
AA Change: Q195P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210314
AA Change: Q231P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210979
Meta Mutation Damage Score 0.0753 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Placental ribonuclease inhibitor (PRI) is a member of a family of proteinaceous cytoplasmic RNase inhibitors that occur in many tissues and bind to both intracellular and extracellular RNases (summarized by Lee et al., 1988 [PubMed 3219362]). In addition to control of intracellular RNases, the inhibitor may have a role in the regulation of angiogenin (MIM 105850). Ribonuclease inhibitor, of 50,000 Da, binds to ribonucleases and holds them in a latent form. Since neutral and alkaline ribonucleases probably play a critical role in the turnover of RNA in eukaryotic cells, RNH may be essential for control of mRNA turnover; the interaction of eukaryotic cells with ribonuclease may be reversible in vivo.[supplied by OMIM, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,295,061 probably benign Het
Agbl4 G C 4: 110,478,594 probably benign Het
Ano6 T C 15: 95,949,962 probably null Het
B3gnt8 C G 7: 25,628,311 N55K probably damaging Het
Brox A G 1: 183,282,488 Y252H probably damaging Het
Cfap100 T A 6: 90,403,908 K605* probably null Het
Chd7 A G 4: 8,866,458 T877A probably benign Het
Csmd3 T A 15: 47,695,755 I2371F probably damaging Het
Cwc22 T A 2: 77,924,480 probably benign Het
Cyp2s1 A T 7: 25,805,997 D347E probably damaging Het
Dab1 C A 4: 104,328,572 probably benign Het
Dis3l2 G A 1: 86,990,149 D493N probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Got1l1 A G 8: 27,197,979 W341R probably damaging Het
Gps2 A G 11: 69,915,224 probably benign Het
Haus1 A C 18: 77,766,853 probably benign Het
Itgam T C 7: 128,080,264 S193P probably damaging Het
Itpr2 C A 6: 146,350,045 A1034S probably damaging Het
Lrp5 T C 19: 3,649,476 R270G probably benign Het
Ltbr G A 6: 125,312,740 probably benign Het
Mdga2 T C 12: 66,506,102 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Nwd2 C T 5: 63,806,574 S1167L probably damaging Het
Olfr187 T A 16: 59,036,263 H158L probably damaging Het
Pfkm T C 15: 98,131,665 V719A probably benign Het
Ppfia3 C G 7: 45,361,758 G16A probably damaging Het
Ppp2r3a G A 9: 101,153,822 T245I possibly damaging Het
Ptprd T C 4: 76,133,258 T256A probably damaging Het
Ptprg C T 14: 11,952,706 probably benign Het
Rabgap1 T C 2: 37,469,446 V7A probably damaging Het
Rwdd2b C T 16: 87,436,558 probably benign Het
Saal1 T C 7: 46,689,459 probably benign Het
Sap130 G A 18: 31,650,620 probably benign Het
Serpina1d T G 12: 103,763,787 M379L probably benign Het
Skor2 A C 18: 76,859,299 S239R unknown Het
Slc16a13 A G 11: 70,219,024 L217P probably damaging Het
Slc18b1 T C 10: 23,803,795 M74T probably benign Het
Tacc2 A T 7: 130,626,497 E1637D possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tg A C 15: 66,684,062 I868L probably benign Het
Ttll5 G A 12: 85,891,079 V395I possibly damaging Het
Uba6 C A 5: 86,127,719 C739F probably benign Het
Unc5d A C 8: 28,875,630 V109G possibly damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp462 G T 4: 55,013,000 K507N probably damaging Het
Other mutations in Rnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Rnh1 APN 7 141166731 missense possibly damaging 0.49
IGL01016:Rnh1 APN 7 141164496 splice site probably benign
IGL03156:Rnh1 APN 7 141163183 missense probably damaging 1.00
R0063:Rnh1 UTSW 7 141164196 splice site probably null
R0456:Rnh1 UTSW 7 141162548 missense possibly damaging 0.90
R1223:Rnh1 UTSW 7 141163207 missense probably damaging 1.00
R1741:Rnh1 UTSW 7 141164023 missense probably benign 0.00
R1771:Rnh1 UTSW 7 141164606 missense possibly damaging 0.55
R4508:Rnh1 UTSW 7 141164543 missense possibly damaging 0.90
R5348:Rnh1 UTSW 7 141163408 missense probably damaging 0.99
R5581:Rnh1 UTSW 7 141163381 missense probably benign 0.00
R6752:Rnh1 UTSW 7 141163441 missense probably benign 0.00
R6932:Rnh1 UTSW 7 141163183 missense probably damaging 1.00
R7536:Rnh1 UTSW 7 141160812 missense possibly damaging 0.92
R8152:Rnh1 UTSW 7 141160704 missense probably damaging 1.00
R8334:Rnh1 UTSW 7 141168631 missense probably benign 0.01
R8791:Rnh1 UTSW 7 141162433 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTTGGAGGCCACAACATCGCAC -3'
(R):5'- AGCCTGGCAGCTCTAGGTATTCAC -3'

Sequencing Primer
(F):5'- GCACAGATCCTTGCAGTTGG -3'
(R):5'- GGTATTCACTGTGCCTGAATAACC -3'
Posted On2013-11-18