Incidental Mutation 'R1125:Ppara'
ID96089
Institutional Source Beutler Lab
Gene Symbol Ppara
Ensembl Gene ENSMUSG00000022383
Gene Nameperoxisome proliferator activated receptor alpha
SynonymsPpar, Nr1c1, PPAR-alpha, PPARalpha, 4933429D07Rik
MMRRC Submission 039198-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1125 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85734983-85802819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85789055 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 149 (N149S)
Ref Sequence ENSEMBL: ENSMUSP00000105050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057979] [ENSMUST00000109422] [ENSMUST00000109423]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057979
AA Change: N149S

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059719
Gene: ENSMUSG00000022383
AA Change: N149S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109422
AA Change: N149S

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105049
Gene: ENSMUSG00000022383
AA Change: N149S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109423
AA Change: N149S

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105050
Gene: ENSMUSG00000022383
AA Change: N149S

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit loss of diurnal variation in hepatic fatty acid and cholesterol synthesis, increased hepatic lipid and gonadal adipose stores, impaired skin wound healing, and altered metabolic responses to starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,978 I254T probably benign Het
Abcb5 T C 12: 118,911,547 D630G possibly damaging Het
Anks4b T G 7: 120,182,357 F204V possibly damaging Het
C87436 T C 6: 86,447,362 V282A probably benign Het
Cav3 T A 6: 112,472,296 F92I probably damaging Het
Cbs A T 17: 31,632,831 V66E probably benign Het
Cd226 A G 18: 89,267,922 I172V probably benign Het
Ctns C A 11: 73,187,837 probably null Het
Fam166b A G 4: 43,427,550 I258T probably damaging Het
Gid4 A G 11: 60,424,781 D66G possibly damaging Het
Glra3 A G 8: 56,039,754 D163G possibly damaging Het
Lrrc23 A G 6: 124,776,182 V167A probably benign Het
Nbea A T 3: 55,857,006 L1979* probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Necab1 T A 4: 15,111,257 D57V probably damaging Het
Olfr693 T A 7: 106,678,007 T160S possibly damaging Het
Plekhd1 C A 12: 80,707,224 Q155K possibly damaging Het
Slc30a5 C T 13: 100,803,413 V665M probably damaging Het
Sntb1 T G 15: 55,749,280 T301P probably benign Het
Tlr5 A T 1: 182,973,892 T240S probably benign Het
Ttc5 A G 14: 50,777,878 L92P probably damaging Het
Ttll10 A G 4: 156,035,038 S664P possibly damaging Het
Uhrf1bp1 T C 17: 27,893,449 V1204A probably damaging Het
Vmn2r45 G A 7: 8,485,543 R163C probably benign Het
Vmn2r94 T C 17: 18,257,455 I231M probably damaging Het
Other mutations in Ppara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ppara APN 15 85801067 missense probably benign 0.00
IGL00754:Ppara APN 15 85777642 missense probably damaging 0.99
IGL01409:Ppara APN 15 85777643 missense probably damaging 0.98
IGL02080:Ppara APN 15 85789019 missense possibly damaging 0.74
IGL02442:Ppara APN 15 85801143 missense probably benign 0.19
IGL02810:Ppara APN 15 85777677 missense probably damaging 0.99
IGL02852:Ppara APN 15 85797878 missense probably benign 0.00
R0333:Ppara UTSW 15 85790960 missense probably damaging 1.00
R0551:Ppara UTSW 15 85787105 splice site probably benign
R0883:Ppara UTSW 15 85798171 missense probably damaging 1.00
R1189:Ppara UTSW 15 85798164 missense probably benign 0.04
R1233:Ppara UTSW 15 85798021 missense probably damaging 1.00
R1582:Ppara UTSW 15 85798228 missense possibly damaging 0.69
R1755:Ppara UTSW 15 85797979 missense probably benign 0.14
R1913:Ppara UTSW 15 85801099 missense probably damaging 1.00
R2163:Ppara UTSW 15 85801046 missense probably benign 0.04
R4570:Ppara UTSW 15 85787197 missense probably benign 0.02
R4980:Ppara UTSW 15 85787233 missense probably damaging 0.99
R5117:Ppara UTSW 15 85777761 missense probably benign 0.00
R5749:Ppara UTSW 15 85789028 missense probably benign 0.35
R6199:Ppara UTSW 15 85787233 missense probably damaging 0.99
R6221:Ppara UTSW 15 85777680 missense probably benign 0.02
R6624:Ppara UTSW 15 85791036 missense probably benign 0.24
R7382:Ppara UTSW 15 85787228 missense probably damaging 1.00
R7534:Ppara UTSW 15 85777726 missense probably benign
R7629:Ppara UTSW 15 85798191 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCATGAGAAAGCTGCGCGAAG -3'
(R):5'- TGACATCTTGCCACTCCAGTGACC -3'

Sequencing Primer
(F):5'- GCCCGTCTGGAGGCTTAC -3'
(R):5'- CCATAAGAGTTTCAAGTGCTCTGC -3'
Posted On2014-01-05