Incidental Mutation 'R1022:Drd1'
ID98800
Institutional Source Beutler Lab
Gene Symbol Drd1
Ensembl Gene ENSMUSG00000021478
Gene Namedopamine receptor D1
SynonymsDrd1a, D1 receptor, C030036C15Rik, Gpcr15, Drd-1
MMRRC Submission 039124-MU
Accession Numbers

Genbank: NM_010076.3; Ensembl: ENSMUST00000021932

Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R1022 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location54051183-54055705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54053314 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 294 (M294L)
Ref Sequence ENSEMBL: ENSMUSP00000021932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021932] [ENSMUST00000221470]
Predicted Effect probably benign
Transcript: ENSMUST00000021932
AA Change: M294L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021932
Gene: ENSMUSG00000021478
AA Change: M294L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 244 7.9e-10 PFAM
Pfam:7TM_GPCR_Srsx 33 345 7e-11 PFAM
Pfam:7tm_1 39 331 6.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221470
AA Change: M287L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222706
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D1 subtype of the dopamine receptor. The D1 subtype is the most abundant dopamine receptor in the central nervous system. This G-protein coupled receptor stimulates adenylyl cyclase and activates cyclic AMP-dependent protein kinases. D1 receptors regulate neuronal growth and development, mediate some behavioral responses, and modulate dopamine receptor D2-mediated events. Alternate transcription initiation sites result in two transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show variably abnormalities that may include growth retardation, death after weaning unless given hydrated food, nonresponsiveness to dopamine D1 receptor agonists and antagonists, and normal to hyperactive locomotor activity. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,497,294 N425K probably benign Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Other mutations in Drd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Drd1 APN 13 54053878 missense probably damaging 1.00
IGL00231:Drd1 APN 13 54053467 missense probably benign
1mM(1):Drd1 UTSW 13 54053847 missense probably damaging 1.00
H8786:Drd1 UTSW 13 54053103 missense possibly damaging 0.92
R0166:Drd1 UTSW 13 54053581 missense probably damaging 1.00
R0333:Drd1 UTSW 13 54054063 missense probably damaging 1.00
R0661:Drd1 UTSW 13 54053038 missense possibly damaging 0.90
R1024:Drd1 UTSW 13 54053314 missense probably benign 0.00
R1397:Drd1 UTSW 13 54053554 missense probably damaging 1.00
R1559:Drd1 UTSW 13 54052945 missense probably damaging 0.99
R1907:Drd1 UTSW 13 54053252 missense possibly damaging 0.88
R2128:Drd1 UTSW 13 54053553 missense probably damaging 1.00
R4913:Drd1 UTSW 13 54053167 missense probably benign 0.33
R5592:Drd1 UTSW 13 54054171 start codon destroyed probably null 0.90
R5867:Drd1 UTSW 13 54054163 missense probably benign
R6758:Drd1 UTSW 13 54053289 missense probably benign
R6966:Drd1 UTSW 13 54053545 missense probably damaging 1.00
X0028:Drd1 UTSW 13 54053793 missense probably damaging 1.00
Z1177:Drd1 UTSW 13 54052857 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCCCCGTTGTTGTTGATGCTTAC -3'
(R):5'- AGTCCATGCCAAGAACTGCCAG -3'

Sequencing Primer
(F):5'- TGATGCTTACAGTCTCTATGGC -3'
(R):5'- CAGACCACCACAGGTAATGG -3'
Posted On2014-01-09