Incidental Mutation 'R1022:Fcho2'
ID98802
Institutional Source Beutler Lab
Gene Symbol Fcho2
Ensembl Gene ENSMUSG00000041685
Gene NameFCH domain only 2
Synonyms
MMRRC Submission 039124-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1022 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location98723403-98815449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98732659 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 568 (I568N)
Ref Sequence ENSEMBL: ENSMUSP00000042959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040340] [ENSMUST00000099277]
Predicted Effect probably damaging
Transcript: ENSMUST00000040340
AA Change: I568N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042959
Gene: ENSMUSG00000041685
AA Change: I568N

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 341 351 N/A INTRINSIC
low complexity region 433 456 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
low complexity region 503 520 N/A INTRINSIC
Pfam:muHD 542 808 2.5e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099277
SMART Domains Protein: ENSMUSP00000096883
Gene: ENSMUSG00000041685

DomainStartEndE-ValueType
FCH 8 94 1.74e-19 SMART
low complexity region 342 352 N/A INTRINSIC
low complexity region 434 457 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 504 521 N/A INTRINSIC
Pfam:muHD 543 803 4.7e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225945
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,497,294 N425K probably benign Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,659,272 probably benign Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Other mutations in Fcho2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fcho2 APN 13 98789807 missense probably benign
IGL02058:Fcho2 APN 13 98730906 missense probably damaging 0.98
IGL02516:Fcho2 APN 13 98730212 missense probably benign 0.08
IGL02715:Fcho2 APN 13 98796335 missense probably damaging 1.00
IGL03243:Fcho2 APN 13 98777384 splice site probably benign
R0044:Fcho2 UTSW 13 98755544 intron probably benign
R0087:Fcho2 UTSW 13 98735086 missense probably benign 0.00
R0472:Fcho2 UTSW 13 98748267 missense probably benign 0.01
R0501:Fcho2 UTSW 13 98764515 missense possibly damaging 0.92
R1024:Fcho2 UTSW 13 98732659 missense probably damaging 1.00
R1130:Fcho2 UTSW 13 98748289 missense probably damaging 1.00
R1495:Fcho2 UTSW 13 98749850 critical splice donor site probably null
R1593:Fcho2 UTSW 13 98784807 missense possibly damaging 0.92
R1608:Fcho2 UTSW 13 98726198 missense probably benign 0.01
R1638:Fcho2 UTSW 13 98745895 missense possibly damaging 0.83
R1643:Fcho2 UTSW 13 98784816 missense probably benign 0.00
R2125:Fcho2 UTSW 13 98775898 missense possibly damaging 0.83
R3117:Fcho2 UTSW 13 98777438 missense probably damaging 1.00
R3968:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R3970:Fcho2 UTSW 13 98735056 missense probably benign 0.06
R4079:Fcho2 UTSW 13 98755612 missense probably damaging 0.99
R4816:Fcho2 UTSW 13 98806366 missense probably damaging 1.00
R5338:Fcho2 UTSW 13 98730891 missense probably damaging 1.00
R5437:Fcho2 UTSW 13 98777474 missense possibly damaging 0.95
R5457:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R5733:Fcho2 UTSW 13 98789802 missense probably damaging 0.99
R6136:Fcho2 UTSW 13 98789767 missense probably damaging 0.99
R6186:Fcho2 UTSW 13 98815083 missense probably benign 0.01
R6365:Fcho2 UTSW 13 98789859 missense probably benign 0.20
R7041:Fcho2 UTSW 13 98784826 missense possibly damaging 0.72
R7168:Fcho2 UTSW 13 98789463 missense probably benign
R7218:Fcho2 UTSW 13 98753613 intron probably null
R7243:Fcho2 UTSW 13 98755216 missense possibly damaging 0.94
R7533:Fcho2 UTSW 13 98784799 missense probably benign 0.00
X0018:Fcho2 UTSW 13 98732082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAATCTTAGCAGCACGGCACAC -3'
(R):5'- TCTTCCAAGGATGGCTACCACACAC -3'

Sequencing Primer
(F):5'- CTAACCTGAACACAAGCTGGG -3'
(R):5'- TACCACACACAAAGAAGTATCCTATG -3'
Posted On2014-01-09