Incidental Mutation 'R1215:Mff'
ID99546
Institutional Source Beutler Lab
Gene Symbol Mff
Ensembl Gene ENSMUSG00000026150
Gene Namemitochondrial fission factor
Synonyms
MMRRC Submission 039284-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R1215 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location82724890-82752394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82741888 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 196 (S196T)
Ref Sequence ENSEMBL: ENSMUSP00000124334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073025] [ENSMUST00000078332] [ENSMUST00000160744] [ENSMUST00000160786] [ENSMUST00000160972] [ENSMUST00000161648] [ENSMUST00000162003]
Predicted Effect probably benign
Transcript: ENSMUST00000073025
SMART Domains Protein: ENSMUSP00000072784
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 239 6.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078332
AA Change: S171T

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077446
Gene: ENSMUSG00000026150
AA Change: S171T

DomainStartEndE-ValueType
Pfam:Miff 1 291 2.2e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159279
SMART Domains Protein: ENSMUSP00000123713
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 147 1.6e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160044
SMART Domains Protein: ENSMUSP00000125005
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 130 7.5e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160632
Predicted Effect probably benign
Transcript: ENSMUST00000160744
AA Change: S37T

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125629
Gene: ENSMUSG00000026150
AA Change: S37T

DomainStartEndE-ValueType
Pfam:Miff 1 137 2.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160750
SMART Domains Protein: ENSMUSP00000125223
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 155 6.2e-67 PFAM
Pfam:Miff 144 220 2.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160786
SMART Domains Protein: ENSMUSP00000125230
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 238 6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160972
SMART Domains Protein: ENSMUSP00000124200
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 152 8.1e-60 PFAM
Pfam:Miff 146 218 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161648
SMART Domains Protein: ENSMUSP00000124164
Gene: ENSMUSG00000026150

DomainStartEndE-ValueType
Pfam:Miff 1 243 1.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162003
AA Change: S196T

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124334
Gene: ENSMUSG00000026150
AA Change: S196T

DomainStartEndE-ValueType
Pfam:Miff 1 316 8.1e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188333
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout reduces mitochondrial hyperfusion-induced apoptotic cell death of endothelial cells of cardiac microvessels after induced ischemia/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Art5 C T 7: 102,097,909 R123H probably damaging Het
Azin2 A G 4: 128,949,696 S66P probably damaging Het
Cep295 T C 9: 15,327,882 E1865G probably benign Het
Ces1a A G 8: 93,032,690 C273R probably damaging Het
Cfap44 A G 16: 44,419,303 Y571C probably damaging Het
Cntfr C A 4: 41,662,064 W226L probably damaging Het
Csmd3 A T 15: 48,004,831 probably null Het
Cyp2a4 C T 7: 26,314,801 P468S possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
E130308A19Rik T A 4: 59,690,743 D192E probably benign Het
Fam184b C T 5: 45,584,178 R237H probably damaging Het
Fmn1 T A 2: 113,693,030 Y1247* probably null Het
Grb14 T C 2: 64,917,264 S18G probably benign Het
Hs2st1 G A 3: 144,465,141 T90I possibly damaging Het
Mcc A T 18: 44,468,494 N589K possibly damaging Het
Nyap1 C T 5: 137,735,133 W546* probably null Het
Olfr62 A T 4: 118,666,299 M261L possibly damaging Het
Ppp2r3a A G 9: 101,212,684 S147P probably benign Het
Rsph14 T C 10: 75,025,066 H134R probably benign Het
Slc25a3 G A 10: 91,117,308 A274V possibly damaging Het
Slc43a2 T A 11: 75,562,862 W229R probably damaging Het
Slco4c1 C A 1: 96,828,871 L575F probably damaging Het
Smyd4 T A 11: 75,390,295 I198N possibly damaging Het
Trpm6 A G 19: 18,796,498 D413G probably damaging Het
Ush2a A G 1: 188,957,282 T33A possibly damaging Het
Zfp871 A T 17: 32,775,972 D57E possibly damaging Het
Zfyve9 T C 4: 108,650,229 Q1176R probably benign Het
Other mutations in Mff
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Mff APN 1 82741975 missense probably damaging 1.00
IGL02934:Mff APN 1 82747094 missense probably damaging 1.00
IGL03381:Mff APN 1 82741940 missense probably damaging 1.00
R0652:Mff UTSW 1 82750564 missense possibly damaging 0.91
R0755:Mff UTSW 1 82750605 critical splice donor site probably null
R2074:Mff UTSW 1 82751700 missense probably damaging 1.00
R2078:Mff UTSW 1 82741921 missense probably damaging 1.00
R2365:Mff UTSW 1 82735471 missense possibly damaging 0.74
R4498:Mff UTSW 1 82741780 intron probably benign
R5099:Mff UTSW 1 82750471 intron probably benign
R5867:Mff UTSW 1 82750606 critical splice donor site probably null
R5984:Mff UTSW 1 82731127 missense probably benign 0.00
R6723:Mff UTSW 1 82751666 missense possibly damaging 0.91
R7135:Mff UTSW 1 82747091 nonsense probably null
R7373:Mff UTSW 1 82737117 splice site probably null
R7475:Mff UTSW 1 82745438 splice site probably null
R7792:Mff UTSW 1 82747081 critical splice acceptor site probably null
R8088:Mff UTSW 1 82751649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCTGAGCACACTCATTGC -3'
(R):5'- AGTTCCAGATGCCACACTCAGTCC -3'

Sequencing Primer
(F):5'- AGCACACTCATTGCTGGGTC -3'
(R):5'- TATCTTCCACAACTGAGGGAAAG -3'
Posted On2014-01-15