Incidental Mutation 'R1397:Slc25a48'
ID160197
Institutional Source Beutler Lab
Gene Symbol Slc25a48
Ensembl Gene ENSMUSG00000021509
Gene Namesolute carrier family 25, member 48
Synonyms
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1397 (G1)
Quality Score193
Status Validated
Chromosome13
Chromosomal Location56438355-56474239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 56465051 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 254 (D254A)
Ref Sequence ENSEMBL: ENSMUSP00000021971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021971]
Predicted Effect probably damaging
Transcript: ENSMUST00000021971
AA Change: D254A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021971
Gene: ENSMUSG00000021509
AA Change: D254A

DomainStartEndE-ValueType
Pfam:Mito_carr 3 91 5.3e-20 PFAM
Pfam:Mito_carr 101 204 3.3e-17 PFAM
Pfam:Mito_carr 208 301 1.3e-23 PFAM
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Epb41l3 T A 17: 69,262,348 probably null Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Slc25a48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Slc25a48 APN 13 56464945 splice site probably benign
IGL01746:Slc25a48 APN 13 56470353 missense probably damaging 0.99
IGL03209:Slc25a48 APN 13 56470459 missense probably benign 0.00
R0068:Slc25a48 UTSW 13 56451211 missense probably damaging 1.00
R0068:Slc25a48 UTSW 13 56451211 missense probably damaging 1.00
R0550:Slc25a48 UTSW 13 56448998 missense probably benign 0.03
R1426:Slc25a48 UTSW 13 56448991 splice site probably benign
R1621:Slc25a48 UTSW 13 56470470 makesense probably null
R1937:Slc25a48 UTSW 13 56448998 missense probably damaging 0.99
R4710:Slc25a48 UTSW 13 56463566 missense probably damaging 0.97
R4735:Slc25a48 UTSW 13 56449074 splice site probably null
R6107:Slc25a48 UTSW 13 56465078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGAGACTACAGAAGCAGTCGC -3'
(R):5'- AGGGGAGAGGTCCCATCTACAAAC -3'

Sequencing Primer
(F):5'- GAGGATCAGAAGTCATGTTCCCC -3'
(R):5'- GGAGAGGTCCCATCTACAAACTTAAC -3'
Posted On2014-03-14