Incidental Mutation 'R1397:Epb41l3'
ID160205
Institutional Source Beutler Lab
Gene Symbol Epb41l3
Ensembl Gene ENSMUSG00000024044
Gene Nameerythrocyte membrane protein band 4.1 like 3
SynonymsDAL1P, NBL3, Epb4.1l3, 4.1B
MMRRC Submission 039459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1397 (G1)
Quality Score218
Status Validated
Chromosome17
Chromosomal Location69075683-69289989 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 69262348 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080208] [ENSMUST00000112680] [ENSMUST00000225740] [ENSMUST00000225977]
Predicted Effect probably null
Transcript: ENSMUST00000080208
SMART Domains Protein: ENSMUSP00000079098
Gene: ENSMUSG00000024044

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 556 604 2.1e-29 PFAM
low complexity region 789 802 N/A INTRINSIC
Pfam:4_1_CTD 809 922 1.9e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112680
SMART Domains Protein: ENSMUSP00000108300
Gene: ENSMUSG00000024044

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 566 614 3.2e-28 PFAM
low complexity region 799 812 N/A INTRINSIC
Pfam:4_1_CTD 825 931 2.9e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000223703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223816
Predicted Effect probably null
Transcript: ENSMUST00000224523
Predicted Effect probably null
Transcript: ENSMUST00000224951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225316
Predicted Effect probably benign
Transcript: ENSMUST00000225740
Predicted Effect probably null
Transcript: ENSMUST00000225977
Meta Mutation Damage Score 0.524 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele display a normal phenotype. Mice homozygous for a different knock-out allele exhibit ataxia, gait abnormalities, clasping, hypermyelination, abnormal axon morphology, and decreased internode length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,285,759 E1222G probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankmy2 T C 12: 36,170,441 probably benign Het
Arhgef10l C T 4: 140,544,443 G827D probably damaging Het
Chrac1 A G 15: 73,090,444 D3G possibly damaging Het
Dmrtb1 G C 4: 107,677,039 P349R probably damaging Het
Drd1 A G 13: 54,053,554 Y207H probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fam13b C T 18: 34,445,583 M705I probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Iqgap2 A G 13: 95,632,165 I1409T probably benign Het
Itih1 C T 14: 30,929,905 probably benign Het
Itih5 A T 2: 10,240,807 D569V probably benign Het
Krt9 A T 11: 100,192,638 L189Q probably damaging Het
Mfsd11 T C 11: 116,873,297 F368S probably damaging Het
Neb C A 2: 52,243,943 V3343F probably damaging Het
Nfe2l3 T C 6: 51,433,294 S130P probably benign Het
Nid1 G A 13: 13,508,795 A1153T possibly damaging Het
Nr2c2 T C 6: 92,149,764 I78T probably benign Het
Nrp1 T G 8: 128,418,716 Y84* probably null Het
Pate2 T A 9: 35,669,695 F2I probably damaging Het
Pign A G 1: 105,657,771 S18P probably damaging Het
Pla2r1 T A 2: 60,534,762 T155S probably benign Het
Rabl3 C T 16: 37,539,974 probably benign Het
Rhbg C T 3: 88,248,446 V66I probably benign Het
Rimkla C T 4: 119,468,111 G367E probably benign Het
Rnpepl1 C A 1: 92,917,159 T391N probably damaging Het
Rnps1 C T 17: 24,412,057 probably benign Het
Rrs1 G A 1: 9,545,767 E82K probably damaging Het
Slc25a48 A C 13: 56,465,051 D254A probably damaging Het
Slc28a2 T A 2: 122,460,531 C659* probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata31d1a C T 13: 59,705,039 probably benign Het
Srrm1 A C 4: 135,321,431 probably benign Het
Srrt A G 5: 137,300,261 V247A possibly damaging Het
Tnks2 T C 19: 36,880,501 probably benign Het
Trim33 A G 3: 103,310,434 probably benign Het
Trim42 T A 9: 97,365,621 I341F probably damaging Het
Trim55 T C 3: 19,644,637 F10S probably benign Het
Trpm1 T C 7: 64,217,658 W369R probably damaging Het
Vps13d C T 4: 145,141,334 R1976H probably damaging Het
Other mutations in Epb41l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Epb41l3 APN 17 69207861 splice site probably benign
IGL01099:Epb41l3 APN 17 69210193 missense possibly damaging 0.80
IGL01578:Epb41l3 APN 17 69248709 missense probably damaging 1.00
IGL02269:Epb41l3 APN 17 69247573 missense probably damaging 1.00
IGL02926:Epb41l3 APN 17 69247746 missense probably damaging 1.00
IGL03397:Epb41l3 APN 17 69248692 missense probably damaging 1.00
E0370:Epb41l3 UTSW 17 69274804 missense possibly damaging 0.73
P0031:Epb41l3 UTSW 17 69259054 nonsense probably null
R0032:Epb41l3 UTSW 17 69210384 critical splice donor site probably null
R0056:Epb41l3 UTSW 17 69253397 missense probably damaging 1.00
R0092:Epb41l3 UTSW 17 69286750 missense probably damaging 1.00
R0499:Epb41l3 UTSW 17 69247659 missense probably benign 0.00
R0560:Epb41l3 UTSW 17 69274897 critical splice donor site probably null
R1164:Epb41l3 UTSW 17 69274767 missense possibly damaging 0.93
R1170:Epb41l3 UTSW 17 69259180 nonsense probably null
R2080:Epb41l3 UTSW 17 69253468 missense possibly damaging 0.54
R2138:Epb41l3 UTSW 17 69207880 missense probably damaging 1.00
R2279:Epb41l3 UTSW 17 69270650 missense possibly damaging 0.56
R2863:Epb41l3 UTSW 17 69210321 missense probably benign 0.22
R3883:Epb41l3 UTSW 17 69274116 nonsense probably null
R3884:Epb41l3 UTSW 17 69274116 nonsense probably null
R4165:Epb41l3 UTSW 17 69207888 missense probably damaging 1.00
R4795:Epb41l3 UTSW 17 69248719 critical splice donor site probably null
R5286:Epb41l3 UTSW 17 69262273 missense probably benign 0.00
R5303:Epb41l3 UTSW 17 69257449 missense probably damaging 1.00
R5373:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5374:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5938:Epb41l3 UTSW 17 69259071 missense probably damaging 1.00
R6014:Epb41l3 UTSW 17 69283960 missense probably damaging 0.98
R6059:Epb41l3 UTSW 17 69284642 missense probably damaging 1.00
R6059:Epb41l3 UTSW 17 69286798 missense probably damaging 1.00
X0066:Epb41l3 UTSW 17 69259158 nonsense probably null
Z1088:Epb41l3 UTSW 17 69253522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGGTCCAGGTGATGCTGAAAG -3'
(R):5'- AGCTGCTGAAAGTCTTGCAAAACAC -3'

Sequencing Primer
(F):5'- ATACAGTATGGAGGTCCCTGC -3'
(R):5'- GAGAGACTGAGCTGTTGCTAAGA -3'
Posted On2014-03-14