Incidental Mutation 'R1572:Lct'
ID170809
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Namelactase
SynonymsLPH, LOC226413, Lphl
MMRRC Submission 039611-MU
Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R1572 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location128284756-128328318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128294195 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1536 (F1536L)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
Predicted Effect probably benign
Transcript: ENSMUST00000073490
AA Change: F1536L

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: F1536L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162067
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,740,673 T85M probably damaging Het
5430419D17Rik T A 7: 131,244,831 Y777* probably null Het
Actn1 A G 12: 80,172,957 probably benign Het
Afap1l1 A T 18: 61,737,499 S603T probably damaging Het
Ahcy T C 2: 155,068,931 Y39C probably benign Het
Ankmy2 T C 12: 36,186,942 probably null Het
Anxa13 A T 15: 58,348,807 noncoding transcript Het
Aoc1 T C 6: 48,905,786 S221P possibly damaging Het
Arhgef10 C A 8: 14,991,211 A770D possibly damaging Het
Arhgef19 A G 4: 141,254,754 D707G probably benign Het
Arhgef3 G A 14: 27,401,735 R444H probably damaging Het
Asphd1 T C 7: 126,949,099 I11V probably benign Het
Atp2b1 A G 10: 98,994,675 M333V probably benign Het
BC051665 T C 13: 60,785,027 Y40C probably damaging Het
Ccdc87 T A 19: 4,840,313 S278T probably benign Het
Chaf1b G A 16: 93,901,230 G463D possibly damaging Het
Chrna4 T C 2: 181,029,307 T219A possibly damaging Het
Clcnkb T G 4: 141,407,095 T584P possibly damaging Het
Clptm1l T C 13: 73,607,747 S161P probably benign Het
Cmya5 T C 13: 93,094,269 E1437G possibly damaging Het
Col13a1 A T 10: 61,866,426 probably null Het
Col3a1 T C 1: 45,345,968 S82P possibly damaging Het
Cpeb3 A T 19: 37,139,082 M383K probably benign Het
Cr2 T A 1: 195,163,314 H111L probably damaging Het
Cttnbp2 T C 6: 18,375,975 S1522G possibly damaging Het
Cul3 T C 1: 80,282,789 D281G possibly damaging Het
Cyp2c70 T G 19: 40,183,982 K72T probably benign Het
Cyp39a1 A T 17: 43,680,129 I110F probably damaging Het
Cyp46a1 T A 12: 108,351,939 M203K probably null Het
Cyp8b1 A T 9: 121,914,958 V436D possibly damaging Het
Ddx17 T C 15: 79,538,565 D324G probably damaging Het
Dopey2 A G 16: 93,770,153 N1274S probably damaging Het
Dscaml1 G A 9: 45,721,333 V1166I probably benign Het
Dsp T C 13: 38,195,738 V1554A probably damaging Het
Dusp27 C T 1: 166,099,455 V863M possibly damaging Het
Efr3a T A 15: 65,854,792 probably null Het
Egfem1 A T 3: 29,648,271 N223I probably benign Het
Egr2 T C 10: 67,539,975 S147P probably damaging Het
Elmo3 A G 8: 105,308,301 T408A probably benign Het
Flnb A G 14: 7,883,908 D378G probably damaging Het
Foxj2 T A 6: 122,833,261 M193K probably benign Het
Gm6327 A G 16: 12,760,156 noncoding transcript Het
Gm7694 T C 1: 170,302,766 H21R probably benign Het
Gpr107 A G 2: 31,167,025 D43G probably damaging Het
Grid2 T A 6: 64,429,694 Y679* probably null Het
Grin2c G A 11: 115,256,074 P432S possibly damaging Het
H2-M10.1 A G 17: 36,325,733 F60L possibly damaging Het
Hectd4 A G 5: 121,301,878 D1147G possibly damaging Het
Idua G T 5: 108,680,589 A223S probably benign Het
Ifi206 T C 1: 173,486,853 Q7R probably benign Het
Itgad T A 7: 128,203,234 V986E probably damaging Het
Itsn2 G A 12: 4,650,044 R670H probably benign Het
Kdm4a T C 4: 118,138,949 E961G possibly damaging Het
Klra5 T A 6: 129,906,622 I91L probably damaging Het
Kntc1 A G 5: 123,772,113 T525A probably damaging Het
Lmod1 T A 1: 135,363,933 D175E probably benign Het
Lonrf1 A C 8: 36,233,972 D361E probably benign Het
Lrrc19 T C 4: 94,638,429 Y297C probably damaging Het
Mast4 T C 13: 102,736,923 E1787G possibly damaging Het
Mpp2 G A 11: 102,060,548 A452V probably benign Het
Msh2 T C 17: 87,718,652 V686A possibly damaging Het
Mthfd1 C T 12: 76,270,419 Q15* probably null Het
Mtnr1b A T 9: 15,863,142 I207N probably damaging Het
Nid2 A G 14: 19,805,412 T1207A probably benign Het
Nin A T 12: 70,038,750 V1569D probably damaging Het
Nov T A 15: 54,749,252 M219K possibly damaging Het
Nrcam T A 12: 44,537,364 probably benign Het
Nsd1 T A 13: 55,246,969 H897Q probably damaging Het
Olfr102 A T 17: 37,313,480 N301K probably benign Het
Olfr1364 T A 13: 21,574,310 I49F possibly damaging Het
Olfr77 G T 9: 19,920,912 K234N probably benign Het
Olfr979 A G 9: 40,001,194 F11S probably benign Het
Paip1 T C 13: 119,451,784 probably benign Het
Pcnx3 G A 19: 5,685,347 R484* probably null Het
Pdxk A G 10: 78,447,980 Y127H probably damaging Het
Phf20 T A 2: 156,287,834 V442E probably benign Het
Phlpp1 G A 1: 106,392,789 D1505N probably damaging Het
Pkhd1 T C 1: 20,347,440 T2496A probably benign Het
Pkhd1l1 A G 15: 44,543,473 T2369A probably benign Het
Plod2 T A 9: 92,603,067 probably benign Het
Pnpla7 T A 2: 25,015,251 M617K possibly damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkch T A 12: 73,649,357 probably null Het
Prr12 G A 7: 45,028,800 H1974Y unknown Het
Prr16 A G 18: 51,302,970 I174V probably benign Het
Prss45 A T 9: 110,838,429 T39S probably benign Het
Pum1 T A 4: 130,718,204 D161E probably damaging Het
Rad51ap2 A G 12: 11,457,112 D345G probably damaging Het
Ralgapb A G 2: 158,446,199 probably benign Het
Rasgrp3 A G 17: 75,500,734 H262R possibly damaging Het
Rnf213 T A 11: 119,436,611 I1809N probably damaging Het
Ryr1 A G 7: 29,062,191 L3177P probably damaging Het
Scyl2 C A 10: 89,650,956 R230L probably damaging Het
Sfxn2 T C 19: 46,582,476 probably benign Het
Slc18b1 T C 10: 23,798,741 probably benign Het
Spata31d1d T C 13: 59,728,191 H510R probably benign Het
Stab1 A T 14: 31,150,823 N1109K probably damaging Het
Sult3a2 A G 10: 33,781,977 S47P probably damaging Het
Tenm3 T C 8: 48,228,993 N2518S possibly damaging Het
Tex21 G T 12: 76,206,891 P416Q probably benign Het
Tex38 T C 4: 115,780,306 N100S probably benign Het
Thsd4 A C 9: 60,394,553 probably benign Het
Ticrr T C 7: 79,681,824 V723A probably damaging Het
Tmprss15 A G 16: 79,090,829 V30A probably benign Het
Uba3 A G 6: 97,185,337 probably benign Het
Ubr1 T C 2: 120,935,319 probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Vmn2r112 A T 17: 22,603,144 T268S possibly damaging Het
Wfdc3 T C 2: 164,744,194 probably benign Het
Zfp282 T A 6: 47,892,867 L282Q probably damaging Het
Zfp422 A T 6: 116,626,784 C85S probably damaging Het
Zfp790 A T 7: 29,828,139 Q83L probably benign Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128287556 missense probably benign 0.09
IGL00970:Lct APN 1 128304068 missense probably damaging 1.00
IGL01022:Lct APN 1 128300859 missense probably benign
IGL01878:Lct APN 1 128294266 missense probably damaging 1.00
IGL01892:Lct APN 1 128307605 missense probably damaging 1.00
IGL02307:Lct APN 1 128286590 missense possibly damaging 0.70
IGL02434:Lct APN 1 128303790 missense probably damaging 0.97
IGL02559:Lct APN 1 128294266 missense probably damaging 1.00
IGL02623:Lct APN 1 128308251 missense probably benign 0.01
IGL02818:Lct APN 1 128300168 missense probably damaging 1.00
IGL02949:Lct APN 1 128313132 missense probably benign 0.26
IGL02951:Lct APN 1 128300211 missense probably damaging 1.00
IGL03087:Lct APN 1 128300375 missense possibly damaging 0.81
IGL03227:Lct APN 1 128327689 missense probably benign 0.09
ANU18:Lct UTSW 1 128308047 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0135:Lct UTSW 1 128285123 missense probably damaging 0.98
R0145:Lct UTSW 1 128327895 missense probably benign 0.00
R0179:Lct UTSW 1 128327685 missense probably benign
R0331:Lct UTSW 1 128298742 splice site probably benign
R0366:Lct UTSW 1 128286462 missense probably benign 0.03
R0399:Lct UTSW 1 128300525 missense probably damaging 1.00
R0492:Lct UTSW 1 128300582 missense probably damaging 1.00
R0548:Lct UTSW 1 128285195 missense probably damaging 1.00
R0691:Lct UTSW 1 128308234 missense probably benign 0.00
R0755:Lct UTSW 1 128294135 missense possibly damaging 0.46
R0839:Lct UTSW 1 128286609 missense probably benign 0.00
R1128:Lct UTSW 1 128301309 missense probably damaging 0.99
R1135:Lct UTSW 1 128294124 critical splice donor site probably null
R1321:Lct UTSW 1 128300022 missense probably benign
R1448:Lct UTSW 1 128307822 missense probably damaging 0.99
R1450:Lct UTSW 1 128307903 missense probably damaging 1.00
R1582:Lct UTSW 1 128300562 missense probably damaging 1.00
R1668:Lct UTSW 1 128287722 splice site probably null
R1757:Lct UTSW 1 128301257 missense probably damaging 1.00
R1775:Lct UTSW 1 128300301 missense probably damaging 1.00
R1792:Lct UTSW 1 128327942 missense possibly damaging 0.54
R1815:Lct UTSW 1 128300159 missense probably damaging 1.00
R1932:Lct UTSW 1 128294161 missense probably damaging 1.00
R2325:Lct UTSW 1 128304226 missense probably damaging 1.00
R2381:Lct UTSW 1 128304121 nonsense probably null
R3001:Lct UTSW 1 128304226 missense probably damaging 1.00
R3002:Lct UTSW 1 128304226 missense probably damaging 1.00
R3003:Lct UTSW 1 128304226 missense probably damaging 1.00
R3011:Lct UTSW 1 128301372 missense possibly damaging 0.74
R3082:Lct UTSW 1 128287608 missense probably damaging 1.00
R3683:Lct UTSW 1 128304226 missense probably damaging 1.00
R3684:Lct UTSW 1 128304226 missense probably damaging 1.00
R3726:Lct UTSW 1 128304226 missense probably damaging 1.00
R3886:Lct UTSW 1 128304226 missense probably damaging 1.00
R3887:Lct UTSW 1 128304226 missense probably damaging 1.00
R3888:Lct UTSW 1 128304226 missense probably damaging 1.00
R4019:Lct UTSW 1 128304226 missense probably damaging 1.00
R4027:Lct UTSW 1 128285181 missense probably benign 0.00
R4226:Lct UTSW 1 128304226 missense probably damaging 1.00
R4409:Lct UTSW 1 128304226 missense probably damaging 1.00
R4514:Lct UTSW 1 128300514 missense probably benign
R4570:Lct UTSW 1 128299904 missense probably benign 0.01
R4776:Lct UTSW 1 128300387 missense probably damaging 0.99
R5001:Lct UTSW 1 128308241 missense probably damaging 0.96
R5021:Lct UTSW 1 128300565 missense probably benign 0.38
R5318:Lct UTSW 1 128304372 missense probably damaging 1.00
R5330:Lct UTSW 1 128298529 missense probably benign 0.06
R5385:Lct UTSW 1 128311617 missense possibly damaging 0.63
R5499:Lct UTSW 1 128286677 missense probably damaging 1.00
R5508:Lct UTSW 1 128294131 missense probably damaging 1.00
R5642:Lct UTSW 1 128295232 missense probably damaging 1.00
R5724:Lct UTSW 1 128300336 missense probably benign
R6026:Lct UTSW 1 128300018 missense probably benign
R6044:Lct UTSW 1 128307980 missense possibly damaging 0.95
R6175:Lct UTSW 1 128327714 missense probably damaging 1.00
R6277:Lct UTSW 1 128304237 missense probably benign 0.01
R6412:Lct UTSW 1 128327718 missense probably benign 0.00
R6480:Lct UTSW 1 128294320 missense probably damaging 1.00
R6526:Lct UTSW 1 128300478 missense probably benign 0.05
R6620:Lct UTSW 1 128295072 critical splice donor site probably null
X0052:Lct UTSW 1 128307630 missense probably damaging 1.00
YA93:Lct UTSW 1 128301320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGATGGAATGGAGGATTTGACCC -3'
(R):5'- CGCTCTGACTTGCTCATAGGTGAC -3'

Sequencing Primer
(F):5'- CCTGTAGAGACAGGGTTTCCAAC -3'
(R):5'- CTCATAGGTGACCATGTATCACTGG -3'
Posted On2014-04-13