Incidental Mutation 'R1724:Galntl5'
ID191667
Institutional Source Beutler Lab
Gene Symbol Galntl5
Ensembl Gene ENSMUSG00000028938
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Synonyms1700021B12Rik
MMRRC Submission 039756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1724 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location25181460-25220297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 25220122 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 379 (N379K)
Ref Sequence ENSEMBL: ENSMUSP00000110616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030778] [ENSMUST00000045737] [ENSMUST00000066954] [ENSMUST00000114965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030778
AA Change: N412K

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030778
Gene: ENSMUSG00000028938
AA Change: N412K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 365 4.1e-10 PFAM
Pfam:Glycos_transf_2 118 304 4.2e-30 PFAM
Pfam:Glyco_tranf_2_2 118 383 1.7e-7 PFAM
Pfam:Glyco_transf_7C 277 349 2.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045737
SMART Domains Protein: ENSMUSP00000036240
Gene: ENSMUSG00000038072

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 151 386 5.3e-9 PFAM
Pfam:Glycos_transf_2 154 337 3.7e-33 PFAM
Pfam:Glyco_transf_7C 315 383 2.1e-9 PFAM
RICIN 476 607 7.09e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066954
SMART Domains Protein: ENSMUSP00000068775
Gene: ENSMUSG00000054116

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
low complexity region 67 77 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114965
AA Change: N379K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110616
Gene: ENSMUSG00000028938
AA Change: N379K

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 82 332 1.8e-10 PFAM
Pfam:Glycos_transf_2 85 271 3.3e-28 PFAM
Pfam:Glyco_tranf_2_2 85 350 8.1e-8 PFAM
Pfam:Glyco_transf_7C 244 316 2.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196213
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Male heterozygous mice for this allele were infertile due to decreased sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 T C 2: 26,991,294 V761A probably benign Het
Arap1 G T 7: 101,400,526 A1032S possibly damaging Het
Atg4d C T 9: 21,268,445 H230Y probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bcdin3d T A 15: 99,470,680 K213* probably null Het
Cep295nl T A 11: 118,333,028 E330V probably benign Het
Col10a1 A G 10: 34,395,718 Y562C probably damaging Het
Col9a2 G A 4: 121,053,902 R578Q probably damaging Het
Creld1 A G 6: 113,484,574 D85G possibly damaging Het
Cth A T 3: 157,913,727 V153D probably damaging Het
Dazap2 T A 15: 100,618,003 Y71N probably damaging Het
Ddah1 A C 3: 145,891,506 D269A probably damaging Het
Dhx9 A C 1: 153,458,488 D975E probably benign Het
Erich3 T A 3: 154,762,327 D805E possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Gabpb2 T C 3: 95,206,515 D19G probably damaging Het
Gabrr1 T A 4: 33,161,651 M325K probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm21964 C A 8: 110,110,163 T227N probably damaging Het
Gm42791 C A 5: 148,959,501 probably benign Het
Gm5356 G A 8: 89,187,056 noncoding transcript Het
Kifap3 C T 1: 163,783,097 R49* probably null Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lce1l A T 3: 92,850,419 V44E unknown Het
Lmbr1 T A 5: 29,361,083 E48D probably benign Het
Nes C A 3: 87,977,441 N958K probably benign Het
Nwd1 A C 8: 72,711,620 H1432P probably damaging Het
Olfr651 T C 7: 104,553,228 F103S probably damaging Het
Olfr715b G A 7: 107,106,202 H220Y probably benign Het
Osgepl1 A G 1: 53,317,903 T75A probably benign Het
Perm1 T C 4: 156,218,072 S358P possibly damaging Het
Pramef17 C T 4: 143,993,432 G121D probably benign Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Sdc4 G T 2: 164,431,286 Q35K probably benign Het
Secisbp2 A G 13: 51,670,846 S377G probably benign Het
Spag16 G C 1: 70,493,782 G540A probably damaging Het
Sun1 T A 5: 139,235,725 D517E probably benign Het
Taf3 A G 2: 9,952,366 V177A probably benign Het
Thbs2 A G 17: 14,685,900 L246P possibly damaging Het
Trpm1 G T 7: 64,235,821 G862* probably null Het
Trpm8 A T 1: 88,350,856 T584S possibly damaging Het
Ythdc2 T C 18: 44,828,690 S2P probably benign Het
Zc2hc1c G T 12: 85,289,812 R81L probably benign Het
Zfp292 C A 4: 34,811,237 L602F probably damaging Het
Other mutations in Galntl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Galntl5 APN 5 25195351 missense probably damaging 1.00
IGL01637:Galntl5 APN 5 25189825 splice site probably benign
IGL02126:Galntl5 APN 5 25189841 missense possibly damaging 0.75
IGL02136:Galntl5 APN 5 25220062 missense probably benign 0.16
IGL02836:Galntl5 APN 5 25186239 missense probably benign
R0076:Galntl5 UTSW 5 25186072 critical splice acceptor site probably null
R0411:Galntl5 UTSW 5 25220174 missense probably benign 0.20
R1376:Galntl5 UTSW 5 25186288 missense probably benign 0.16
R1376:Galntl5 UTSW 5 25186288 missense probably benign 0.16
R1686:Galntl5 UTSW 5 25210434 missense probably benign 0.16
R1899:Galntl5 UTSW 5 25198532 nonsense probably null
R2213:Galntl5 UTSW 5 25217529 missense probably benign 0.13
R2215:Galntl5 UTSW 5 25198478 missense probably damaging 1.00
R2425:Galntl5 UTSW 5 25220081 missense probably damaging 0.99
R3811:Galntl5 UTSW 5 25186180 missense probably benign 0.19
R3812:Galntl5 UTSW 5 25186180 missense probably benign 0.19
R4072:Galntl5 UTSW 5 25198480 nonsense probably null
R4660:Galntl5 UTSW 5 25203379 missense probably damaging 1.00
R5792:Galntl5 UTSW 5 25198463 missense possibly damaging 0.59
R5844:Galntl5 UTSW 5 25186093 intron probably benign
R6267:Galntl5 UTSW 5 25186165 missense probably benign
R6296:Galntl5 UTSW 5 25186165 missense probably benign
R6896:Galntl5 UTSW 5 25189949 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACCTGATGTTTGCTATCATGACCTG -3'
(R):5'- AGCGTACTTCTCTACTGTTGAGGTCC -3'

Sequencing Primer
(F):5'- GATGTTTGCTATCATGACCTGATCAC -3'
(R):5'- TGAGGTCCTTATGCCCACAAC -3'
Posted On2014-05-14